Match the proteins with their function in DNA replication. unwinds DNA at replication fork forms covalent phosphodiester bonds to join DNA fragments remove primer and replace the RNA with DNA, also has 3'-> 5'exonuclease activity for proofreading synthesizes DNA by adding to the 3' end of the growing strand of DNA adds RNA primer uses an RNA template to facilitate extension of the telomeres in eukaryotes helicase DNA ligase DNA polymerase II introduces a double-stranded break ahead of the replication fork and swivels the cleaved ends around the central axis to relieve the stress of helix unwinding DNA polymerase III DNA primase telomerase DNA Gyrase (topoisomerase) ◆ <> <>

Match the proteins with their function in DNA replication. unwinds DNA at replication fork forms covalent phosphodiester bonds to join DNA fragments remove primer and replace the RNA with DNA, also has 3'-> 5'exonuclease activity for proofreading synthesizes DNA by adding to the 3' end of the growing strand of DNA adds RNA primer uses an RNA template to facilitate extension of the telomeres in eukaryotes helicase DNA ligase DNA polymerase II introduces a double-stranded break ahead of the replication fork and swivels the cleaved ends around the central axis to relieve the stress of helix unwinding DNA polymerase III DNA primase telomerase DNA Gyrase (topoisomerase) ◆ <> <>

Biology: The Unity and Diversity of Life (MindTap Course List)

15th Edition

ISBN:9781337408332

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter8: Dna Structure And Function

Section: Chapter Questions

Problem 2CT: Review Figures 8.12 and 8.13. In cells, the primers for DNA synthesis are short strands of RNA, so...

See similar textbooks

Similar questions

Review Figures 8.12 and 8.13. In cells, the primers for DNA synthesis are short strands of RNA, so each newly-synthesized strand of DNA has a segment of RNA al its 5 end. As replication proceeds, DNA polymerases remove these RNA segments and fill in the resulting gaps with DNA. However, the gaps at the very 5 ends of the new strands cannot be filled in with DNA. Why not? DNA replication leaves exposed about 100 nucleotides al the 5 end of each template strand, and these single-stranded ends are removed. What are the effects of this "end problem" on a cell's DNA as it continues to divide? FIGURE 8.12 DNA replication. Green arrows show the direction of synthesis for each strand. The Y-shaped structure where the DNA molecule is being unwound is called a replication fork. FIGURE 8.13 Discontinuous synthesis of DNA. This close-up of a replication fork shows that only one of the two new DNA strands is assembled continuously. The other is assembled in short segments.
AKS 5b: Which statement is correct regarding the semiconservative nature of DNA? * The semiconservative nature of DNA allows for genetic stability in somatic gene production MRNA operates as a template to allow DNA to replicate itself using ribosomes The structure of the phosphate group on the DNA molecule direct the correct nucleotides into place during replication Nucleotides in each original strand serve as a template for the new strand to be made AKS 5b: Which model accurately represents the semi-conservative nature of DNA replication? * * AA AA AA AA АВ ВА AA BB AA AA АВ АС Figure A Figure B Figure C Figure D
Origin of replication [ Choose ] [Choose] Codon Complementary pairs with cytosine in a DNA molecule The site of protein synthesis Ribozyme This molecule can begin the synthesis of a polymer of nucleotides without a primer A short peice of lagging stand DNA Primase A reflection of redundancy in the genetic code RNA which exhibits enzymatic properties Okazaki Fragment The process of making RNA from DNA Helicase DNA polymerase Transcription Enzyme which lays down a segment of RNA on replicating DNA so that DNA nucleotides can polymerize A sequence of three nucletotides which codes for an amino acid Ribosome Point Mutation Chromosome Wobble Position The point on a stand of DNA where replication begins Mitochondria RNA polymerase [ Choose ] Guanine
Match the enzymes involved in DNA replication with their function. Primase [ Choose ] [ Choose] Synthesizes short RNA segment to initiate new DNA strand Helicase Main enzyme that extends RNA primer by adding DNA nucleotides to it Stabilizes single-stranded DNA Relieves over-winding of DNA ahead of the replication fork Removes RNA primers preceding Okazaki fragment and replaces RNA nucleotides with DNA nucleotides Single-stranded binding proteins Unwinds DNA helix Synthesizes the ends of the linear chromosome Seals nicks between adjacent DNA segments DNA polymerase III [ Choose ] DNA polymerasel [ Choose ] DNA Ligase [ Choose ] Topoisomerase [ Choose ]
Match the proteins with their function in DNA replication. unwinds DNA at replication fork forms covalent phosphodiester bonds to join DNA fragments remove primer and replace the RNA with DNA, also has 3'-> 5'exonuclease activity for proofreading synthesizes DNA by adding to the 3' end of the growing strand of DNA adds RNA primer uses an RNA template to facilitate extension of the telomeres in eukaryotes introduces a double-stranded break ahead of the replication fork and swivels the cleaved ends around the central axis to relieve the stress of helix unwinding helicase [Choose ] ✓ helicase telomerase DNA polymerase II DNA polymerase I DNA polymerase III DNA primase DNA ligase D DNA Gyrase (topoiso- merase) exonuclease
nd 2 minutes): Any RNA polymerase in any organism: O A Synthesizes RNA chains in the 3 to-5" direction O B. Binds tightly to a reqion of DNA located thousands of base pairs away from the transcobed rogion of the DNA OC Has proofreading activity O D. Separates DNA strands throughout a long region of DNA (up to tinousands of base pairs) and then copies one of them. OE Has a subunit called A (lambda), which acts as a proofreading ribonuclease OF. Can initiate synthesis of a new RNA chain without a primer
During DNA replication, the function of RNA primers is to Group of answer choices serve as a binding site for DNA ligase separate the two strands of the double helix to open replication "bubbles" serve as starting points for DNA strand elongation by DNA polymerase in the 3' - 5' direction prevent new-separated strands of DNA from rejoining serve as starting points for DNA strand elongation in the 5' - 3' direction by DNA polymerase
he bases of one of the strands of DNA in a regionwhere DNA replication begins are shown at the endof this problem. What is the sequence of the primerthat is synthesized complementary to the bases inbold? (Indicate the 5′ and 3′ ends of the sequence.)5′ AGGCCTCGAATTCGTATAGCTTTCAGAAA 3′
In DNA Replication, what is the function of Primase: works to connect discontinuous parts of DNA such as the nicks created by gyrase and the okazaki fragments O Synthesizes RNA on a DNA template to provide an available 3'-OH group to continue with DNA synthesis O binds at the origin and begins to unwind the helix O bind near the origin to maintain the complementary sequences of DNA from reforming the helical structure
Compare and contrast the properties of DNA polymerase and RNA polymerase. Drag the appropriate items to their respective bins. can proofread using a 3'-to-5' exonuclease activity polymerize in a 5'-to-3' direction Only RNA can initiate strand synthesis catalyze phosphodiester bond formation to polymerize nucleotides into nucleic acids Only DNA use deoxyribonucleotide triphosphates as substrates can only extend an existing strand Both Reset Help dependent on a DNA sequence template use ribonucleotide triphosphates as substrates
DNA strand below: 3’ T A C A T G C C G A A T G C C 5’ Discuss how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used. Look at the genetic code to know what amino acid will become part of the polypeptide chain. 1. Give the discussion of the entire procedure
COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGC