Match each statements below with the appropriate letter from the replication fork diagram. 1. Removed by DNA polymerase 2. 5' end of template DNA 3. Activity of this enzyme creates Supercoils 4. Lagging strand 5. This enzyme catalyses phosphodiester bond formation
Q: Comparison of Mitosis and Meiosis Mitosis Meiosis 1. Number of divisions 2. Chromosome number of dau...
A: INTRODUCTION Mitosis This is a cell division by which a parent cell divide into two identical daught...
Q: A mother with type A blood type and a father with type B blood type have a child with blood type AB....
A: Introduction For A blood group genotype is either IA IA or, lA IO . For B blood group genotype ...
Q: Do you think the human species can continue raising its global carrying capacity? How so, or why not...
A: Carrying capacity represents the population size that the environment can maintain for an indefinite...
Q: What are 20 vegetable and field crops grown in Jamaica?
A:
Q: Describe the phenotype of individuals who inherit two copies of the HbS allele-Sickle Cell Disease.
A: Sickle cell anemia It is a genetic disorder that affects erythrocytes(RBC) causing them to become s...
Q: Can you explain genetic map with two point cross? And show me a example with the cross
A: Genetic map use to create by using information obtain through series of test cross. A cross between ...
Q: Answer the following questions: How many carpels are fused to form an apple? How might the fleshy p...
A: Answer the following questions: 1. How many carpels are fused to form an apple? 2. How might the fle...
Q: What is an evolutionary tree? Is there a precise evolutionary tree known by science that explains th...
A: Evolutionary tree also known as phylogenetic tree: it is a map/chart that gives the visual view that...
Q: Make simple diagrams tracing the life history of Taenia solium.
A: The pig tapeworm, Taenia solium, is a cyclophyllid cestode belonging to the Taeniidae family of cycl...
Q: Using the concepts of non-mendelian genetics, what the phenotypic ratio of the offspring if two hete...
A: Option b is correct - 3 pea plant with purple flower : 1 pea plant with light violet flower. BB or B...
Q: Science is a subject or a discipline, a field of study that deals with the process of learning. This...
A:
Q: What are two obvious features of interphase in plant or animal cells?
A: The interphase represents the duration between two succesive mitotic divisions. It is the period in ...
Q: Describe the experimental rationale that allowed the lacrepressor to be isolated ?
A: A gene is a fundamental unit of heredity and a grouping of nucleotides in DNA (deoxyribonucleic acid...
Q: Eggs subjected to an isotonic solution will have a measured circumference that
A: Introduction: Isotonic solution:Two solutions with the same osmotic pressure over a semipermeable me...
Q: Can you explain a genetic map with the three point testcross
A: A genetic map is a special kind of chromosome map that depicts the relative positions of genes and o...
Q: The diagram shows the levels of organization for an organism. organism 3 1 cells What levels are rep...
A: Humans, like other multicellular organisms, possess organ systems which work together to perform out...
Q: Are the caloric sweeteners used in food safe?
A: Sugars are a refined form of glucose that is a disaccharide (8-9 units of monomers) of carbohydrates...
Q: Thoko’s father suffered a heart attack recently. He is 48 years old, does not exercise, is overweig...
A: ANSWER: Tholo's father suffered a heart attack, he does not exercise, is overweight, and Smokes hea...
Q: What is the function of Coronary arteries ?
A: Coronary arteries are a type of artery which spreads around the entire heart like a network of blood...
Q: The presence of a dimple on the cheek is governed by a dominant gene. A couple had already 4 childre...
A: The alleles are the alternative forms of a gene that are located on the same locus of a homologous c...
Q: The species Canis Lupus (Gray Wolf) is most closely related to which of the animals listed: Group of...
A: ANSWER;- All options are wrong Explain;- The species Canis Lupus (Gray Wolf) is most closely related...
Q: Your mother bought some meat from the market one day. She placed the meat in a pan but forgot to pla...
A: The reason for these consequences could be the rotting of meat. Maggots and flies are attracted to r...
Q: Circle the letter of each sentence that is true about evolutionary relationship of organisms? * ...
A:
Q: What are the advantage and disadvantages of genetic engineering. Give at least five each.
A: The use of recombinant DNA or rDNA technology to change an organism's genetic makeup is referred to ...
Q: Coal miners inhale large quantities of fine coal dust when they are working in the mines. Over the y...
A: Introduction: Coal miners are at a very high risk of developing lung disorders such as pneumoconiose...
Q: Find the hash mark indicating the origin of jaws. Which group or groups of vertebrates possess jaws?...
A: Vertebrates are the chordates that have a vertebral column.
Q: Which is true? * the different skin colors signifies multiple alleles * creeper gene in chickens a...
A: Mendelian inheritance refers to patterns of inheritance that are characteristic of organisms that re...
Q: Describe the malaria is and where it is prevalent- in what areas of the globe and in what habitats?(...
A: A parasite is a parasitic creature that lives inside or on the host. A different organism serves as ...
Q: Explain the fates of the ancestral prokaryotes.
A: Progenate represents the precellular stage formed during the origin of life on the earth.
Q: Name the three muscles making up heart wall? Where is each located and their respecFve funcFons?
A: * Heart wall consists of layers : Pericardium Epicardium Myocardium Endocardium Pericardium is t...
Q: Compare and contrast trophic levels, food chains, and food webs. How are these concepts related, and...
A: Food Chain : The transfer of food energy from the soured in plants through a series of organisms wit...
Q: Show the pathway for the biosynthesis of pectin compound in plant using glucose or galactose as prec...
A: Pectin is structurally and functionally the most complex polysaccharide in plant cell walls. Pectin ...
Q: Which of the following changes in morphology or physiology are likely to happen as an organism gets ...
A: Answer :- Option (H) is correct. - All of the above. - The changes in morphology or physiology are l...
Q: re 52 codons but only 51 amino acids in this protein. Why? (please refer to the attachment - the on...
A: The basic building block of the nucleic acid id known as the nucleotides. The messenger RNA and DNA ...
Q: Which of the following is not a function of the plasma membrane? (a) transports materials (b) helps ...
A:
Q: Can an eadthworm be capable of sensing? Make your predictions below by writing YES or NO on the spac...
A: Earthworm is a terrestrial invertebrate belonging to phylum Annelida in Kingdom Animalia.
Q: One of the concerns with GMO is the toxicity of product by GMO when consumed by humans. Suppose that...
A: Translation is the process by which protein is synthesized by ribosome from the genetic codon presen...
Q: HAWAIIAN HONEYCREEPER What mechanism of evolution is applied in this diagram? Explain your answer.
A: Evolution can be defined as orderly change in flora and fauna which existed over millions of year on...
Q: Draw a cell during the steps of Meiosis I (prophase, metaphase, anaphase, and telophase). Give the c...
A: Crossing over is the swapping of genetic material occurs during cell division.In meiosis I crossing ...
Q: A group of bacteria are gram stained. They show up as pink. Which bacteria group is most likely pres...
A: Gram-staining is a technique which is used to differentiate between two types of bacteria on the bas...
Q: What are some industrial processes that use bacteria What are examples of human diseases caused by b...
A: Tuberculosis, pertussis, diphtheria, bacterial meningitis, gonorrhoea, syphilis, bubonic plague, lep...
Q: Fill the table below, indicate at least one possible error in each phase during mitosis Phase Possib...
A: Mitosis is also referred to as equational division. In this process, the replicated chromosome are d...
Q: What are some mechanisms by which pathogenic bacteria cause diseases? Why is this knowledge importan...
A: bacteria use different strategies to enter human body and it cause pathogenicity by septic shock to...
Q: Predict the phenotypes of the progeny and the frequen- cies with which they will occur assuming (a) ...
A: Mutation occurs when a DNA gene is damaged or changed in such a way as to alter the genetic message ...
Q: What is the earthworm’s ability to sense wetness or dryness?
A: A terrestrial annelid worm belongs to the class Oligochaeta is known as the earthworms. In other wor...
Q: Which of the following are two hallmarks of the adaptive immune system? a. Immediate and Broad b. Sp...
A: The immune system safeguards your child's body against external intruders. These include bacteria, v...
Q: Microbial diseases of the integumentary system usually have the same signs and symptoms. How would o...
A: Human skin is composed of two main layers called the epidermis and dermis.
Q: ch of the following statements about the spleen is true or false. If you s false, explain why. atige...
A: Spleen is the part of the lymphatic system. Contain the white blood cells that helps in fighting of...
Q: The image shows the karyotype of someone suffering from Patau syndrome. 2 3 4 5 6 7 8 10 11 12 13 14...
A: Answer b- chromosome set 13. In This karyotype there is an extra copy of chromosome 13.
Q: The human blood is classified into four different blood types, namely A, B, AB, and O, due to the di...
A: Answer :: First we shoud know Agglutination. Agglutination is the formation of the clumps of cells w...
Step by step
Solved in 2 steps
- How does DNA replication occur in a precise manner to ensure that identical genetic information is put into the new chromatid? See Figures 8.12 and 8.13. FIGURE 8.12 In DNA replication, the two polynucleotide strands uncoil, and each is a template for synthesizing a new strand. A replicated DNA molecule contains one new strand and one old strand. This mechanism is called semiconservative replication. FIGURE 8.13 A close-up look at the process of DNA replication. (a) As the strands uncoil, bases are added to the newly synthesized strand by complementary base pairing with bases in the template strand. The new bases are linked together by DNA polymerase. (b) DNA synthesis can proceed only in the 5 3 direction; newly synthesized DNA on one template strand is made in short segments and linked together by the enzyme DNA ligase.The region of DNA, shown below, is being copied. Diagram what happens when the second GT repeat (newly synthesizing strand) slips out (loops out). Diagram what occurs in this and the next round of DNA replication. Describe the change in the DNA sequence that occurs due to this replication slippage. 5’TGCCAGTGTGT3’ACGGTCACACACACATGGAG5’Arrange the following to the correct sequence that shows the process of DNA replication. 1. Unwinding of DNA and formation of replication fork II. Proofreading of strands and replacing any errors during the synthesis. III. Synthesizing a new strand that matches the template, by extending the primer via the addition of the nucleotides to the 3' end. IV. Formation of semiconservative strands
- Fill in the blanks in the following statements about DNA replication. 3' Parental strand 5' 2. Then 3. The enzyme DNA daughter strand. 4. A binds with KEY CAGTGTAACGGTGA Adenine Guanine GTCAC LLLLL Cytosine Thymine 5' This represents DNA replication. 1. The replication bubble opens up as the hydrogen bonds between bases are broken by the enzyme Daughter strands Incoming nucleotide GTCACATTGCCACT GGTGA Parental strand 3' C binds with 5. What enzyme prevents recoiling of the DNA strand while synthesis is occurring? DE Segment 2 proteins keep the two helixes apart. adds the new nucleotides to the parental strand to produce the DNA polymerase -DNA nucleotide Segment 1 DNA polymerase ? Refer to the picture above and indicate your answers. 6. DNA polymerase is adding the nucleotides to the top strand continuously--that means the top strand is the (leading or lagging) strand. 7. The bottom strand has short segments which are added discontinuously. This is the (leading, lagging) strand.…Match these replication associated terms with the appropriate definition or function. L Separates DNA strands to expand the replication bubble. Uses template strand to synthesize complete RNA transcripts. II. DNA polymerase . Cleaves the bond between two adjacent nucleotides in a strand. III. Primase DNA consensus sequence at the 5' end of a gene where synthesis begins. IV. Ligase DNA sequence where replication will be initiated. V. V. Synthesizes leading and lagging strands. Helicase VIL Synthesizes RNA primers to initiate strand synthesis. origin VIL Covalently links the DNA backbones of Okazaki fragments.Some Processes Involved in DNA Replication 1. The replication origin is identified. 2. DNA primase builds RNA primer. 3. Okazaki fragments are spliced by DNA ligase. 4. Helicases bind and uncoil the DNA double helix. 5. RNA primer is the starting point for DNA polymerase. 6. DNA replication ends at the telomere where DNA codes for termination. 7. DNA polymerase adds complementary nucleotides in the 5' to 3' direction in short segments called Okazaki fragments. The sequence in which the events numbered above occur during DNA replication of the lagging strand is , and
- DNA strand below: 3’ T A C A T G C C G A A T G C C 5’ Discuss how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used. Look at the genetic code to know what amino acid will become part of the polypeptide chain. 1. Give the discussion of the entire procedureMatch the following descriptions with the enzymes involved in DNA replication. 1. Adds an RNA primer to begin elongation 2. Removes the RNA primer from the beginning of the newly constructed strands 3. Splices lagging strand segments 4. Cleaves the rung of the DNA double helix ladder Description: DNA DNA Helicase Primase Enzyme: Polymerase LigaseWhich statement about Okazaki fragments is true? Select one: O a. They are necessary because DNA polymerase can only build DNA in the 5' to 3' direction, so for one of the strands at each fork, the DNA polymerase can only build away from the fork. O b. They correct errors made during earlier phases of DNA replication. O c. They act as a primer that initiates DNA replication. O d. They prevent the ends of chromosomes from shortening with every replication. e. DNA polymerase doesn't need a primer to build these fragments.
- Please match the following enzymes with their correct functions. Primase, Gyrase, Ligase, Polymerase, Helicase, Topoisomerase 1.Unwinds DNA at the replication fork. 2.Makes and reseal breaks in the double-helical DNA to release the torque that builds up as a result of unwinding at the replication fork. 3.Synthesizes a short RNA to provide a 3’ -OH group for the attachment of DNA nucleotides. 4.Removed RNA primers and replace them with DNA. 5.Joins Okazaki fragments.Match Column A with Column B. unwinds the two DNA strands at the replication A. DNA Gyrase fork B. Primase stabilize ssDNA as it forms so it will not anneal C. Helicase to reform the double helix releases the tension (positive supercoils) ahead D. Single-strand DNA binding proteins (SSB) of the replication fork caused by the unwinding of the DNA helix E. DNA polymerase synthesizes DNA v proofread the newly synthesized DNA v remove RNA in lagging strand initiates DNA synthesis by placing first RNA on the DNA template v removing errors in the newly synthesized DNA filing in the gaps in Lagging strand > >The diagram shows a model of DNA replication. The diagram points out a number of enzymes and protein factors involved in the process. If this cell were cancerous, a doctor might be using a chemotherapy drug to prevent the replication process from taking place. One such drug, topotecan, inhibits the topoisomerase enzyme from working. Based on the model, if topotecan is used, how will this affect the replication process? A: The hydrogen bonds between the bases will not break B: The double helix of the DNA molecule will not unwind C: It will prevent the addition if complementary nitrogen bases to the leading or lagging DNA strands D: It will prevent the addition of nitrogen bases due to instability of the single-stranded DNA chains