Answered: Initiation of translation in E. coli…

Initiation of translation in E. coli requires: Question 26 options: methionyl-tRNA 60S Ribosomal subunit 40S Ribosomal subunit Kozak sequence mRNA

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Related questions

Q: Tt O 8. What are the driving forces that promotes tertiary -3D and quaternary -4D structure…

A: Proteins are the biological macromolecules. They show great diversity in their structure and…

Q: The hydrolysis of sucrose has the following data. Time (min) 0 30 60 90 130 180 [Sucrose] (M) 0.5011…

A: To determine the half-life of the reaction, first identify the order of the reaction. The order of…

Q: How do glucagon and epinephrine affect glycogen in the liver? They increase both glycogen breakdown…

A: Glucagon is a polypeptide hormone secreted by the alpha cells of Iselets of pancreas. Glucagon is…

Q: You obtained the following raw data when setting up a Biuret standard curve: Absorbancy BSA (mg/ml)…

A: Proteins are large biomolecules made up of amino acid residues linked via a peptide bond. Amino…

Q: Q5. Each ionizable group of an amino acid can exist in one of two states, charged or neutral. The…

A: Amino acids are simply an alpha-carbon bonded to 4 groups. The 4 groups are;an alpha-carboxyl group…

Q: Cellulose contains___ linkages that ___ be digested by animals. a β1--> 4 glycosidic ; canNOT b…

A: Cellulose is a polymer of units. It is used by plants and some microbes as a means of mechanical…

Q: (1) the complete systematic names for sugars A, B and C (remember to you pyranosyl or furanosyl…

A: Furanoses are 5 membered rings consisting of 4 carbon and 1 oxygen atom. Pyranoses are 6 membered…

Q: Write the name for the trisaccharide depicted below (for example, of the form a - D-xylofuranose).…

A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…

Q: STEM Workplace Practices Q2

A: The objective of the question is to understand the role of stability testing in ensuring the quality…

Q: Consider the following Peptide: Alanine-Lysine-Glutamine-Serine-Glycine Select all that applies Give…

A: Peptides are short chain of amino acids linked by peptide bonds. Amino acids that have been…

Q: 4. In the reaction in which glyceraldehyde 3-phosphate is oxidized to 3-phosphoglycerate, which…

A: The process of oxidation and reduction in a reaction is collectively called Redox reaction. During a…

Q: To better understand how the lacR works, let's start let's approximate the volume of a bacterial…

A: The bacterial cell is considered as a cylInder. The equation to find volume of cylinder is ''.

Q: Consider the following structure. CO₂CH2CH3 CO₂CH2CH3 This substance could be produced by the…

A: True.As it was a Diels-Alder Reaction so the given structure will be produced.Explanation:It is a…

Q: You have isolated a new trisaccharide from a new species of insect shown below that you are calling…

A: The dashed bonds will come below the plane of the ring and the wedge bonds will become above the…

Q: Consider the malate dehydrogenase reaction from the citric acid cycle. Given the listed…

A: The free energy change for the malate dehydrogenase reaction of the TCA cycle is ≈21.122…

Q: [AktivGrid] Draw the product of the reaction of isocitrate catalyzed by isocitrate dehydrogenase in…

A: Isocitrate dehydrogenase catalyzes the irreversible decarboxylation of isocitrate to yield…

Q: 2. Peter does not tolerate lactose in milk. He bought a solution of ẞ-galactosidase where [Eo]=10.0…

A: To determine the initial rate of reaction (Vo) Vo = Vmax [C]KM +[C]…

Q: A) H H₂N-C-C <=0 CH2 OH ОН н D) H2N-C-C <=0 CH2 OH HO CH3 B) H₂N-C H3C-CH CH2 CH3 0= OH E) H2N-c-c С…

A: Amino acids are simply an alpha-carbon bonded to 4 different groups. The 4 groups are;an alpha-amino…

Q: Create a figure that includes a schematic of the topological map of AlaE. In your topological map,…

A: Topology data from 3 different techniques; hydropathy profile analysis, TMHMM and TOPCONS are…

Q: ACTIVITY 10.7.1 Complete the table below for the gluconeogenesis with their corresponding precursor…

A: The metabolic process in the liver called "gluconeogenesis" creates glucose from precursors that are…

Q: The effects of hydroxymethylaspartate as an inhibitor for this enzyme was studied. The following…

A: The Lineweaver-Burk plot, also known as a double reciprocal plot, is a graphical representation of…

Q: One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base…

A: According to Watson-Crick base pairing rule, adenine (A) pairs with thymine (T) while guanine (G)…

Q: The rate of the reaction of glycogenn with inorganic phosphate, P₁, to form glucose-1-phosphate and…

A: For a chemical reaction: The rate law equation below describes the mathematical relation between the…

Q: a. How many peptide bonds are there? b. How many amino acid residues are there? c. In exact order,…

A: As per Bartelby Guidelines, we can answer only three subparts of a question. So, kindly post other…

Q: You are sprinting around a track and at about the 200 meter mark you start to feel a burning…

A: Fermentation is defined as an anaerobic process in which even during absence of oxygen, energy can…

Q: The enzyme urease increases the rate of urea hydrolysis at pH 8.0 and 20 °C by a factor of 10¹4.…

A: timeuncatalyzed = 5.70x108 yearsExplanation:The given information indicates that urease increases…

Q: GQ6

A: The objective of the question is to identify the phase of cell division in which an even number of…

Q: An individu with chronic hypoglycemia was suspected of having a defect in one of the enzymes unique…

A: Glycolysis is the conversion of glucose to 2 pyruvate molecules. Gluconeogenesis is the conversion…

Q: Create a fishbone diagram for the process of creating an acceptable calibration curve for the…

A: In order to prepare a calibration curve for the spectroscopic determination of rHCA (recombinant…

Q: Genetics Question 13

A: The question is asking whether the proximity of two genes on a chromosome affects the number of…

Q: Cooperativity yields a sigmoidal kinetic curve. Which of the following is TRUE?

A: Co-operativity can be described as a phenomenon where the enzyme shape changes with the substrate…

Q: graph the data from the table after taking recipocals of [S], V without inhibitor and V with…

A: Plot between the reciprocal of V (velocity of reaction) and S (concentration of substrate) is known…

Q: During metaphase of mitosis, a cell from this organism would have a) A single line of 3 chromosomes…

A: Mitotic metaphase is the stage in nuclear division where the chromosomes line up in a single line…

Q: QUESTION 2 10 11 12 Glucose Pyruvic acid 2 ATP Lactic acid 13 36 ADP 36P 36 ATP Match the FOLLOWING:…

A: Answered the question.

Q: 23. Write free energy change (AG), standard free energy change (AG), and biochemical free energy…

A: Free energy change () is the change in Gibbs free energy at any instant under consideration. The…

Q: Draw a parallel beta sheet and an antiparallel beta sheet (three strands each). Show the hydrogen…

A: The secondary structure of protein refers to the local folded structure that forms within in…

Q: Melting Temperature (Tm) of a dsDNA molecule is the temperature at which a 100% of…

A: The correct answer is:c. 50% of the dsDNA exists in a single-stranded (denatured) form.…

Q: v (mm/sec) 5.0 4.0 3.0 2.0 1.0 0.0 0.0 Estimate from the M-M plot below: Vmax, Km, Keat, and enzyme…

A: The rate (v) v/s substrate concentration ([S]) graph of enzymes that follow MM (Michaelis-Menten)…

Q: If non-disjunction occurs at meiosis 2 in a male, 2 of the 4 sperm formed in that meiosis will have…

A: Non-disjunction can happen in meiosis 1 or meiosis 2.Non-disjunction is said to have taken place in…

Q: 111: 900 Page 3 (b) Construct an energy-level diagram of 2-pentene showing the relative energy…

A: Already done Explanation:Step 1: Step 2: Step 3: Step 4:

Q: Biochemistry...Represent the reactions when Phosphatidylethanolamine was treated with; (I)…

A: Phosphatidylethanolamine (PE) is a type of phospholipid found in cell membranes. It consists of a…

Q: Which of the following is true about a mixed type inhibition? a. None of these is true b. A…

A: The enzyme kinetics, inhibition in particular, is vital to understanding and purposefully managing…

Q: Sketch graphs expected for the Product concentration Vs substrate concentration.

A: Enzymes can be defined as proteins that help to speed up the metabolism. They basically act as…

Q: Can you help with q3 please, thank you.

A: The intermolecular interactions for the given active site of RNA is listed below . Explanation:Step…

Q: what is The standard free energy change for the combined system that you wrote in the previous…

A: The standard free energy change (∆G°) of a chemical reaction is the free energy change at the…

Q: A coal fire plant uses 1 kg of coal to generate 1000 kWh of electricity and emits 50 kg of CO2 and 5…

A: The objective of the question is to understand the relationship between the functional unit (FU) and…

Q: Draw a set of free energy diagrams that show the differences between a spontaneous reaction that…

A: Free energy diagrams have free energy (G) in Y-axis and reaction coordinate in X-axis. These can…

Q: Genetics Question 8

A: The objective of the question is to identify the correct event that occurs during the prophase of…

Q: Sketch out the binding site of Hemoglobin with oxygen bound . ( You can abstract the Heme ring out…

A: Hemoglobin is a metalloprotein that contains iron. Hemoglobin is present in the red blood corpuscles…

Q: If the Gibbs free energy change for the reaction; Succinate + FAD Fumarate + FADH2 is -40KJ/mol at…

A: Biological oxidation-reduction reactions involve the transfer of electrons from one biomolecule,…

Concept explainers

Genetic Recombination

Recombination is crucial to this process because it allows genes to be reassorted into diverse combinations. Genetic recombination is the process of combining genetic components from two different origins into a single unit. In prokaryotes, genetic recombination takes place by the unilateral transfer of deoxyribonucleic acid. It includes transduction, transformation, and conjugation. The genetic exchange occurring between homologous deoxyribonucleic acid sequences (DNA) from two different sources is termed general recombination. For this to happen, an identical sequence of the two recombining molecules is required. The process of genetic exchange which occurs in eukaryotes during sexual reproduction such as meiosis is an example of this type of genetic recombination.

Microbial Genetics

Genes are the functional units of heredity. They transfer characteristic information from parents to the offspring.

Question

Initiation of translation in E. coli requires:

Question 26 options:

	methionyl-tRNA
	60S Ribosomal subunit
	40S Ribosomal subunit
	Kozak sequence
	mRNA

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step by step

Solved in 1 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.

Similar questions

Question / G 3 G2 G1 G 5 G 4 GGU AUG GCC AUG CUC CUc UUC ACG GAG UAC CGG R (the strand) Y CUC GAG AAG The original template for this process is: O DNA O TRNA O FRNA O MRNA
To which of the following tRNA structures is the amino acid attached with during aminoacylation? Question 40 options: D arm 3' acceptor arm Variable arm Anti-codon loop TψC arm
Before the next elongation cycle can take place at a ribosome, the peptide chain of the peptidyl-tRNA has to be transferred to the ___ site and the deacylated tRNA has to move to the ___site. Question 46 options: A, P P, A A, E P, E there is no peptidyl transfer happening during protein translation
Posttranslational modifications of proteins do not include: peptide bond formation glycosylation acetylation of N-terminal peptide bond cleavage disulfide bond formation QUESTION 16 14 15 16 streptomycin puromycin 17 18 19 20 Which one of the following antibiotics does NOT function by interfering with the translational/post-translation process tunicamycin penicillin O tetracyclin O O
put in correct order the steps for initiating translation. 1. Binding of initiator tRNA to mRNA 2. Binding of large ribosomal subunit to mRNA 3. Binding of small ribosomal subunit to mRNA 4. Binding of tRNA with 2nd amino acid to the A site 5. Formation of covalent bond between methionine and second amino acid A) 1, 2, 3, 4, 5 B) 3, 1, 2, 4, 5 C) 1, 3, 2, 4, 5 D) 2, 3, 1, 4, 5 E) 3, 2, 1, 4, 5
Answer the following questions regarding the diagram (below) showing translation. The ribosome is shown as the blue and green structure, the RNA is the horizontal line labeled with nucleotide abbreviations, and the tRNAs are shown as colored blocks with the anticodon paired to the codon. • What stage of translation is shown? elongation • Which position shows the "A" position? right side (no tRNA) • Which end of the RNA is the 5' end? left end • Which base of the anticodon of the blue tRNA "GAC" (as shown in the diagram) is the 5' end of the anticodon? the C U! UCUGCUACUAGUAACACGU
Which of the following statement(s) about the tRNA molecule is NOT correct? Question 39 options: tRNA is the cellular "interpreter molecule"; plays a crucial role in the translation of the genetic code into an amino acid sequence tRNA molecules have a complex 3-dimensional structure resembling an "L" 't' stands for transfer, because tRNA molecules transfer cellular amino acids to the ribosome aminoacyl-tRNA molecules are mostly found in the nucleus of a cell each tRNA has an amino acid-binding site as well as an anti-codon site
Answer the following questions regarding the diagram (below) showing translation. The ribosome is shown as the blue and green structure, the RNA is the horizontal line labeled with nucleotide abbreviations, and the tRNAs are shown as colored blocks with the anticodon paired to the codon. • What stage of translation is shown? elongation • Which position shows the "A" position? right side (no tRNA) • Which end of the RNA is the 5' end? left end • Which base of the anticodon of the blue tRNA "GAC" (as shown in the diagram) is the 5' end of the anticodon? the C CUAGAC UAGAUCUGCUACUAGUAACACĞU
015347/quizzes/5825797/take 21. The processing events that must occur on the MRNA after it is transcribed, but before it is released into the nucleus include (select all that apply) Primary RNA transcript Exon 1 Intron Exon 2 Intron Exon 3 RNA processing Spliced RNA Exon 1 Exon 2 Exon 3 AAAAAAA 5' cap Poly-A tail 3' untranslated region 5' untranslated region O folding into its functional shape O splicing out exons O adding a poly-A tail O removal of non-coding sections O capping the 5' end hp
Consider this list (below) of steps involved in translation. These steps are out of order. TRANSLATION: 1. the small and large ribosomal sub-units unite2. two amino acids join together.3. another tRNA anti-codon bonds with another mRNA codon 4. an initial tRNA bearing a specific amino acid arrives at the ribosome 5. the process continues until a protein molecule is completed6. at the synthesis site, initial mRNA codons are inserted
Indicate whether each of the following events occurs when tryptophan is high or when tryptophan is low by placing a check in each of the appropriate blanks. Share your reasoning. Event Tryptophan high Tryptophan low Ribosome does not stall at Trp codons ____________ ____________ Region 2 of the leader pairs with region 3 ____________ ____________ Ribosome covers part of region 2 of leader ____________ ____________ Transcription is terminated before structural genes are transcribed ____________ ____________
How many tRNA molecules can associate with a ribosome at any given time during translation