In the deoxy state of HB, which of the following does not occur? O An intra-chain salt bridge between Val 98 and Tyr 145. O An intra-chain salt bridge between Histidine 146 and Aspartate 94 side chains O A peptide bond between Tyr 145 and His 146. O An inter-chain salt bridge between Histidine 146 and Lys 40
Q: TRUE OR FALSE a) In a dsDNA, a pyrimidine in one chain is always paired with a purine on the other ...
A: DNA is a very important biomolecule as it is responsible for storing all the genetic information and...
Q: From the complete oxidation of glucose (glucose → 6CO2), how many total nucleotide triphosphates are...
A: Glucose is metabolized through the glycolytic pathway to yield energy in the form of ATP and NADH. T...
Q: Characterization of enzyme activity does not allow us to: a. determine how different variables affec...
A: Enzymes are biocatalyst that increases the speed of reaction by lowering the activatio...
Q: Arachidonic acid is made from linolenic acid: True False
A: Arachidonic acid is a polyunsaturated fatty acid, which is important in metabolism, especially in th...
Q: what is the purpose and objectives on doing nitrious acid test?
A: Amines are the compounds and functional groups having a basic nitrogen atom with a lone pair of elec...
Q: Proteoglycans are often made up of glycosaminoglycans (chondroitin sulfate, keratan sulfate, and der...
A: On the basis of composition, proteins can be either simple or conjugated. Conjugated proteins cons...
Q: Give one physiological c
A: pH is the measure of the strength of H+ ion or Hydronium ions in solution. pOH is the ...
Q: Identify things in your house that contain macromolecules. Write down the name and its use as a prod...
A: Macromolecules- Large molecules divided into various classes like the carbohydrates, proteins and li...
Q: Give the equation for the complete titration of aspartic acid with a base, NaOH. At what pH, can you...
A: Amino acids contain ionizable groups and can be titrated. Titration if amino acid illustrates the ef...
Q: Correct statement regarding nucleotide structure removal of the ribose-phosphate group from thymi...
A: DNA and RNA are made up of long chains of nucleotides. Sugar molecule, ribose in RNA, and deo...
Q: An unknown sample was tested if there is a presence of lipid, after the test it shows that it is po...
A:
Q: 4. Molecule #4 a)What Group? (Carb, Lipid, Protein, or Nucleic Acid). b)Within the group, how would ...
A: The nucleotides are phosphorylated derivatives of nucleosides,. Nucleosides are compounds made up of...
Q: TRUE OR FALSE a) The electron rich nature and aromaticity of the nucleobases mediates their absorba...
A: Nucleobases are also known as nitrogeneous bases which are nitrogen-containing biological compounds...
Q: In globins oxygen binds to... Question 37 options: Fe3+ Nitrogen atoms Fe2+ Th proxim...
A: The myoglobin contains a single polypeptide and a single heme group. The hemoglobin acts as the tran...
Q: Suggest whether the following structures are likely to act as cholinergic agonists or not and briefl...
A: Cholinergic agent: The compound which mimic the action of acetylcholine or butyrylcholine are called...
Q: To properly refer to and differentiate the carbon 6 of the nucleobases, the carbon atoms of the suga...
A: All living organisms are made up of cells, which are the most basic unit of life. They are responsib...
Q: 1. Select the odd one out. xylulose b. dihydroxyacetone c. glyceraldehyde d. ribulose С.
A: "Since you have asked multiple question, we will solve the first question for you. If you want any s...
Q: Complete the following diagram, using arrows to show the flow of electrons, for this reaction cataly...
A: GAP dehydrogenase or Glyceraldehyde-3-phosphate dehydrogenase (GADPH) is an enzyme found in the cyto...
Q: What is the Main Rule of Bioenergetics in living organisms? -How does the principal of additive sta...
A: In biology living organism is an individual who perform the characteristics of like growth, movement...
Q: 9. Compare the energy cost, in ATP equivalents, of synthesizing stearate from mitochondrial acety...
A: Stearate is a 18 carbon saturated fatty acid. Lets first look at the amount of ATP equivalents requi...
Q: What properties do each of the following R groups have?
A: Proteins are a type of macromolecule that have a variety of roles in biological processes. It is res...
Q: please provide a mechanism for how Pro-Thr-Pro-Ser amide could rearrange/molecule into a different m...
A: Amino acids are the building unit of proteins/polypeptide chain, consisting of amine group, carboxyl...
Q: A sweetener used in sugarless gums and candies. Explain your answer in 1-3 sentences. a. ribitol b. ...
A: Since you have asked multiple question, we will solve the first question for you. If you want any sp...
Q: A protein is allosterically regulated by a molecule. This molecule enhances the binding affinity, an...
A: Regulation in science refers to the adapted form or change in structure or function of any molecule ...
Q: Which of the following primary sequence of an antibody has the greatest diversity? Question 13 op...
A: Antibody diversity : Gets created via combining of variable regions of H chains and L chains. H - He...
Q: Predominant nucleotides during protein synthesis are the GTPs.
A: The protein synthesis is the most important, essential and significant metabolic activity of living ...
Q: Most enzymes have an optimal pH valuc of O 5 1.5
A: The enzyme is a substance that acts as a catalyst in living organisms, regulating the rate of chemic...
Q: Give some examples of cofactors, and also of mechanisms bywhich cofactors affect enzyme function
A: Cofactors are non-protein molecules associated with the enzymes. Cofactors are commonly metal ions. ...
Q: D. F. G H. Important Values Volume/ml (Caffeine) Intensity 2 Caffeine Buffer (Caffeine] (ASA] 150 pp...
A: Here Stock concentration of Caffeine given is 150PPM To convert this to µg/ml 1µg/ml = 1PPM 150PPM =...
Q: Why is it unfavorable for RNA molecules to adopt a double-helix structure similar to B-DNA?
A: The answer of the following question is given below
Q: What is the function of the buffer hemoglobin in the human body?
A: Hemoglobin is an oligomeric conjugated protein with four peptide chains joined by a non-...
Q: True or False. Write the word “reducing” if the statement is correct, otherwise write “non-reducing”...
A: For the digestion of cellulose cellulase enzyme is needed. However, the human body does not contain ...
Q: Enzymes in the in what part of the body are important in the metabolization of drugs? lungs mu...
A: Drugs are chemical compounds manufactured to improve an abnormal physical and mental state. Since dr...
Q: Enzymes normally enhance the rates of biochemical reactions by preferentially binding and stabilizin...
A: ATP synthase is the enzyme complex that undergoes multiple subunits and thus plays an integral role ...
Q: 2,3 - BPG is ___________ charged, and is surrounded by __________ amino acids when it is bound to HB...
A: 2,3 - Bisphosphoglycerate binds with central cavity of Hb tetramer in RBC.
Q: Helices can be described by the notation nm,where n is the number of residues per helical turn and m...
A: Proteins are a type of macromolecule that have a variety of roles in biological processes. It is res...
Q: What diseases or conditions if you have buffer deficiency in your body?
A: Diseases or conditions if you have buffer deficiency in the body Answer : There are 2 disorders of a...
Q: Which statement about sickle cell anemia is FALSE? Question 28 options: cells containing the m...
A: Sickle cell anaemia is a result of point mutation, change in single amino aci i.e., valine is replac...
Q: True or False. Write the word “reducing” if the statement is correct, otherwise write “non-reducing”...
A: Mutarotation is the change in the optical rotation as change in the equillibrium between two anomers...
Q: 39. Answer and explain
A: Mutagens are agents which cause mutation. Mutation is the change in the sequence of nucleotides in t...
Q: 1. Define the relationship between twist, writhe and linking number. Are the twist and writhe topolo...
A: Twist, with and Linking number are used to define the helical pattern and the orientation of dna str...
Q: CH3CSCOA -02CCH2CSCOA O=
A: The reaction shown the carboxylation of acetyl-CoA to produce malonyl-CoA. This is a thermodynamical...
Q: What are introns? What is the functional importance (if any) of introns?
A: The information regarding the content of genes is in the specific sequences of nucleotides. Most euk...
Q: Which of the following is the result of the hydrolysis of 5'-CTAGTTC-3' at the b side?
A: Nucleic acids are polymers of nucleotides (which consist of phosphate group, sugar and nucleobases)....
Q: Over the last 50 years, the carbon dioxide abundance in the atmosphere has decreased, and the averag...
A: The answer of the following question is given below.
Q: This is DNA. Locate the nitrogen bases (nitrogens are blue). Where are they located in the molecule?...
A: DNA is a nucleic acid that is made up of nitrogen bases, sugar and phosphate groups linked together....
Q: Two proteins bind the same ligand, and the data is shown below. What is the KD value for Protein B? ...
A: The answer of the above question is: Correct answer not given. KD is the equilibrium dissociation co...
Q: Lipoteichoic acid
A: Lipopolysaccharides : lipopolysaccharide (LPS) are the major component found in the outer membrane o...
Q: Complex carbohydrates (glycoproteins and glycolipids) have a special structure that allows it to fun...
A: DISCLAIMER: Since you have asked multiple questions, we have solved the first question for you. If y...
Q: In the following diagram of a portion of a protein, label the types of interactions that are shown. ...
A: Proteins are the polymers of L-amino acids. The structure of proteins is divided into four levels of...
Trending now
This is a popular solution!
Step by step
Solved in 4 steps with 1 images
- Question 4 a-D-galactose from B-D-glucose can be differentiated using which method of analysis? All of these Methylation analysis O Use of exoglycosidases NMR by the change in chemical shiftQUESTION 3 Biocatalysts are effective because: O a. They increase the activation energy of a reaction Ob. They stabilize the transition state O. They decrease the rate of the reaction Od. They decrease the activation energy of a reaction QUESTION 4 Which of the following statements is INCORRECT regarding L-amino acids and D-amino acids? O NH3 group on the left of the chiral carbon in both isomers O b. They are nonsuperimposable mirror images of each other O NH group on the left of chiral carbon in L isomers Od. They are enantiomersQuestion 1 Amyloid Precursor Protein (APP) is actually thought to be a natural neuroprotective agent induced by neuronal stress or injury. O True O False Question 2 Which of the following is not a property of serine protease? A globular protein with high molecular weight ● It is initially synthesized as a zymogen It has uniquely activated tyrosine residue at the active site Cleaves polypeptide at a specific amino acid residue Question 3 RTK is activated by cyclic AMP. O True False
- Question 9 The mechanism for all template-directed synthesis of any type of nucleic acid involves which of the following? A nucleophilic attack of a 3' hydroxyl toward a phosphoryl group of a nucleoside triphosphate, releasing PPi. B nucleophilic attack of a 5' hydroxyl toward a phosphoryl group of a nucleoside triphosphate, releasing PPi. nucleophilic attack of a 5' hydroxyl toward a phosphoryl group of a nucleoside triphosphate, releasing PPi. D nucleophilic attack of a 3' hydroxyl toward a phosphoryl group of a nucleoside monophosphate, releasing Pi.Question one parts A though E a. True / False: Guanine to cytosine intermolecular interactions (hydrogen bonding) is stronger than adenine to thymine. b. What peptide would be made from the following DNA sequence? 5'ATCCCGGGTACTCACTCCCAT3' Start-Gly-Pro-Stop Start-Gly-Ser-Pro-Val-Arg-Val Start-Gly-Gly-Thr-lle-Arg Start-Arg-Arg-Gly-Gly c. Starting from the MRNA strand below - what peptide would be produced? Remember your start and stop codons...5'CCAUGCGGCAUACCAAAUUACUAAACUAGC3' Start-Arg-His-Thr-Lys-Leu-Leu-Asn-Stop Start-Asn-Leu-Leu-Lys-Thr-His-Arg-Stop Start-Arg-Lys-Leu-Asn-Stop Pro-Met-Arg-His-Leu-Leu-Asn d. Which type of RNA comprises over 80% of total cellular RNA? ribosomal RNA Messenger RNA Transfer RNA e. True / False - All of the DNA nucleotides are attached to the deoxyribose in the BETA configuration (at the anomeric carbon of the sugar). B (Ctrl) -Asap
- QUESTION 1 Which of the following concepts in column A best fits the concept in column B. p-Nitrophenyl a-D-Glucoside Action of intracellular a-GLUCOSIDASE + NaHCO3 Boiling cells Tris-pH 5.0 A. Substance that act as molecular mimic of a maltose molecule B. Develops TT-Nitrophenyl into a yellow colour reagent for measurement at 400nm c. Breaks the a-linkages of p-Nitrophenyl a-D-Glucoside, leaving p-Nitrophenyl and a glucose molecule D. Allows transport of p-Nitrophenyl a-D-Glucoside across the membrane E. Stop the reaction and release internal p-NitrophenylQUESTION 28 Which amino acid is most likely to break an alpha helix? Alanine Isoleucine none of the choices are correct Proline QUESTION 29 If an enzyme has a kcat = 3.3e's-1, Km = 5.9e M, what is its catalytic efficiency? Give your answer in 2 significant figures and scientific notation QUESTION 30 To determine the molecular weight of a purified protein you subject it to ESI mass spectrometry at pH=2. The spectrum i t aiahbeni aln hain m tian Click Save and Submit to save and submit. Click Save All Answers to save all ansuers. 786 Mostly cloudy 9 Type here to searchQuestion 16 Concerning SDS-PAGE: |A The gel is a copolymer of agarose and bis- agarose. BA magnetic field drives the migration of the proteins within the gel. C Is usually performed in presence of a molecular weight marker composed of a mixture of polynucleotides of known molecular weight. D The gel behaves like a molecular sieve. E In this type of electrophoresis the proteins migrate from the positive (+) to the neg- ative (-) electrode.
- QUESTION 10 Select a property that does not belong to allosteric enzymes. They conform to hyperbolic Michaelis-Menten kinetics They may have binding sites for regulatory molecules that are separate from active sites They tend to have a signmoidal curve of rate versus [S] They undergo conformation changes as a result of modulator binding.5 pts Question 9 95 58 40 HS HS SH 65 8 M urea and 72 B-mercaptoethanol 65 Hs84 Hs- SH 72 26 HS 110 SH 84 26 110 95 124 40 58 Native ribonuclease Denatured reduced ribonuclease Figure 2.53 Biochemistry, Seventh Edition O 2012 W. H. Freeman and Company The image above shows how Anfinsen unfolded ribonuclease for his classic experiment to see if proteins contain all necessary information for adopting their folded states on their own. To achieve proper refolding and ribonuclease activity, Anfinsen must have: trick question: ribonuclease cannot adopt its folded state without the help of cellular machinery removed the mercaptoethanol followed by the urea very carefully removed both the urea and mercaptoethanol at the same time removed the urea followed by the mercaptoethanolQuestion 11 Given this MRNA strand: 3' - AUGAGGAAGGUA - 5'; what are the components of the polypeptide? First Position Third Position (3' end) (5' end) U A G UGU Cys UUU Phe UUC Phe UCU Ser UCC Ser UCA Ser UAU Tyr UAC Tyr UAA Stop UAG Stop |U UGC Cys UUA Leu UUG Leu UGA Stop |A UGG Trp U G CGU Arg CGC Arg CGA Arg UCG Ser CAU His САС His CAA Gln CAG Gln CUU Leu CCU Pro U ССС Pro CỤC Leu CỦA Leu CUG Leu CCA Pro A CCG Pro CGG Arg G U AAU Asn AAC Asn AAA Lys AAG Lys GAU Asp GAC Asp GAA Glu GAG Glu AUU Ile ACU Thr АСС Thr ACA Thr ACG Thr AGU Ser AUC Ile A AUA Ile AGC Ser AGA Arg A AUG Met* AGG Arg G GUU Val GGU Gly GCU Ala GCC Ala GCA Ala GCG Ala U GGC Gly GÚC Val G GUA Val GGA Gly |A GUG Val GGG Gly G