In the chain elongation of proteins, the new aminoacyl-tRNA bonds to? a.A site b.E site c.G site d.P site
Q: 4. Draw in all the lone pairs on each structure. Briefly compare the size/shape of each molecule.…
A: In a covalent bond, where there is sharing of electrons and not a transfer of electrons, the pair of…
Q: What structural differences exist between oligosaccharides and polysaccharides?
A: Carbohydrates are the biomolecules that are made up of monosacharides as monomers. Depending on the…
Q: 7. What does Gram staining reveal owing to its use in clinical diagnosis? Explain briefly.
A: The process of determining a condition, disease, or damage based on its signs and symptoms. A…
Q: Tylenol 3 with Codeine is an example of a _______________ drug. A) Schedule II B) Schedule III C)…
A: The Controlled Substances Act (CSA) Title II of the Comprehensive Drug Abuse Prevention and Control…
Q: Why is the enzyme added last? Why can’t it be added at the start and the rates measured sometime…
A: For an enzyme catalysed reaction, the graph of the initial rate of reaction vs substrate…
Q: Question 4: Tropomyosin is a 93 kDa protein which sediments at 2.6S (the sedimentation coefficient S…
A: Hemoglobin - is a oxygen and carbon dioxide transport protein kin red blood cells. It is a spherical…
Q: Calculate the amount of ATP that can be produced from one molecule of maltose metabolized…
A: Glycolysis is the collection of 10 enzymatically catalysed reactions that oxidises a 1 molecule of…
Q: Posttranslational modifications of proteins do not include: peptide bond formation glycosylation…
A: Proteins are one of the essential biomolecules for life. These are formed by translation from the…
Q: Chymotrypsin is a digestive enzyme with a catalytic optimum between pH 7.8 and 8.0. However, due to…
A: Henderson-Hasselbalch equation relates pH, pKa and the ratio of concentrations of protonated to…
Q: 7. Organisms have a mucleus surrounded by a nuclear- membrane. Genetic material is concentrated…
A: A cell is a smallest structural and functional unit of organisms. Cellular arrangement or the…
Q: You obtained the following raw data when setting up a Bradford standard curve: BSA (mg/ml) 0 1 2 3 4…
A: The biuret assay can be used for quantitative determination of total protein concentration by…
Q: Determination of the Effect of Concentration on the Gelling Property Ideal Gelling Concentration…
A: Carrageenan is a polysaccharide that is isolated from red seaweed. Carrageenan is a sulfated…
Q: Which of the following is true about lipid bilayers? A. They are self-forming. B. They are…
A: Lipid bilayers are bimembrane covering or also called as the plasma membrane of the cell. These are…
Q: The C3 pathway can occur in which of the following plants? A. cypresss B.cactus C.banana…
A: The major proportion of plants produce 3-carbon 3-phosphoglyceric acid as a first product during the…
Q: Question 2. You want your recombinant Human Growth Hormone to be tagged at the N-terminus with a…
A: Cloning is a process of making copies of the a segment such that they are exactly similar to the…
Q: Below is a diagram of the canonical Wnt signalling pathway. Numbers 1-7 refer to different molecules…
A: The Wnt signaling pathway is known for its role in cell differentiation, transcriptional regulation…
Q: For the serial dilution, your stock solution must have a concentration of 3.5 mg/mL. How much…
A: Here we are trying to prepare the stock solution from the raw red cell (RBC) solution. The parameter…
Q: How do you construct a DNA sequence, complimentary strand sequence, and mRNA sequence (including…
A: DNA is Deoxyribo Nucleic acid that consists of Nucleotide bases Adenine Guanine Cytosine and…
Q: Consider, for example, that a particular serine residue is phosphorylated to activate the protein.…
A: Phosphorylation refers to process of transfer of phosphate group from one molecule to other…
Q: Which of the following refer/s to viruses? A. They are disease-causing. B. They contain DNA or…
A: Introduction: Viruses are non-cellular microscopic particles that can replicate inside the living…
Q: Chemistry 1. Explain why gluconeogenesis is NOT just a reversal of glycolysis.
A: Hi! Thanks for your question. As you have posted multiple questions and have not mentioned which one…
Q: 11. Based on the denaturation curve shown here for two separate proteins, A and B: a. Label the…
A: The 3-dimensional structure of a protein is dependent on the non-covalent interactions such as…
Q: Glutamine is a conservative replacement for asparagine in the primary s mplies that Gln has a…
A: Aspargine and glutamine are amino acids with polar side chain. They are not charged. They have amide…
Q: would likely be in the center of would likely be associated with the polar head groups and In an…
A: The amino acids are classified as polar and non-polar. The integral membrane proteins are…
Q: which intermediate of the citric acid cycle regulates the flow of metabolites through glycolysis,…
A: The citric acid cycle also known as the Krebs cycle or the TCA cycle is a series of chemical…
Q: The phenol concentration of wastewater was determined from three (3) parallel determinations, giving…
A: As per the given experimental data; Mean of phenol concentration of wastewater: 0.513 μg L-1…
Q: The initial step in the protein translation is described by: O release of the initiation factors…
A: There are 4 Biomacromolecules. They are ; Proteins Nucleic acids Carbohydrates and Lipids
Q: Determine whether each of the examples or phrases describes an essential amino acid, a nonessential…
A: Essential amino acid - those amino acid that cannot be synthesized by the body and must be taken in…
Q: What is the source of acetyl- CoA in plants that enters the glyoxylate cycle? A. NADPH B. proteins…
A: Glyoxylate cycle is a variation of tricarboxylic cycle enables acetyl-CoA to be converted into…
Q: special precautions on how to use this instrument in biochemistry (with thorough explanation) • uses…
A: Biochemistry aims to explain all chemical processes associated with a living cell at the molecular…
Q: 1. Classify the 20 common amino acids B. According to Polarity d. Uncharged nonpolar e. Uncharged…
A: Living body consists of numerous different amino acids amongst which only 20 are standard amino…
Q: How many times does the enzyme Mbol cut between positions 1426-2789 inclusively of the sequence with…
A: The Mbol is a restriction enzyme. Restriction enzymes cleave the double-stranded DNA at the…
Q: What amino acids are most likely to be found in the core of a water-soluble globular protein? a)…
A: Amino acids are biomolecules that have an amino group, a carboxyl group and a side group linked to…
Q: AAC (DNA TRIPLET) = _______(mRNA CODON) = _________ AMINO ACID 2. TCG (DNA TRIPLET) = _______ (mRNA…
A: Transcription:- process of conversion of DNA to mRNA. Translation:- process of conversion of mRNA…
Q: Which of the following are elongation factors involved in the release of free tRNAs? a.EF-G…
A: The above mentioned elongation factors are involved in the process of translation in prokaryotes.…
Q: RNA is hydrolyzed in basic solution, but DNA is not. This occurs because RNA has modified bases, but…
A: DNA and RNA are the two important biomolecules which are termed to be Nucleic acids that are crucial…
Q: Question: which of the following conditions will lead to decrease in consumption of palmitoyl- COA…
A: Fatty acid beta oxidation takes place in mitochondrial matrix. Acyl CoA is an acyl thioester. This…
Q: 4. An enzyme catalyzed reaction was initiated in 1.0 mL of 0.06 M HEPES buffer, pH 7.55. During the…
A: The Henderson Hasselbalch equation describes the mathematical relationship between the pH and pKa of…
Q: Abosrbance (A 280) You are interested in isolating an enzyme Ribonuclease. Inside cells ribonuclease…
A: Size exclusion chromatography is technique of separation of molecules based on their size. In some…
Q: What is the product of the glyoxylate cycle used by growing seedling? I. glucose II. NADPH III. C02…
A: Glyoxylate cycle is an anabolic pathway which occurs in specialised organelles called glyoxysomes.…
Q: The above reaction coordinate diagram in the presence of enzyme is inconsistent with the "lock and…
A: Enzymes are protein molecules that increase the rate of reaction by decreasing the activation…
Q: What type of chemical reactions are the below 2 reactions? Decomposition or Synthesis?…
A: Decomposition reaction:- Breakdown of larger substance/ molecule into smaller units or parts. Eg:-…
Q: Using a flow diagram, elaborate on how you would generate a recombinant plasmid.
A: Plasmid is a circular double stranded DNA molecule found in bacteria and is capable of self…
Q: A 8 month old girl is taken into the emergency room a few days after receiving her first round of…
A: To defend the body against allergies, viruses, and bacteria, the immune system produces antibodies.…
Q: What are the primary structures of the 1AWJ tyrosine kinase enzyme? What are the secondary…
A: Enzymes are protein molecules. Proteins are composed of twenty standard amino acids that differ from…
Q: Three glucose rings that are bound together is best described as a: O polysaccharide triglyceride O…
A: Biomolecules are required by living organisms for a variety of biological processes, including…
Q: Peptide bond structure is planar and has considerable double bond character permitting rotation…
A: The bond that connects the aminoacids is called Peptide bond. It is formed by dehydration Synthesis…
Q: What biomolecules can be found within a living cell? Define each and talk about how they work in…
A: A living cell is the basic unit of life. It is capable of independent existence (as is the case of…
Q: Che mi c al Reaction water+ reactants enzymes 42. If the reactants are lipids, then the products are…
A: Since the second question is an incomplete question because one of the options is cropped, we will…
Q: The 3° structure of a protein refers to the protein's overall, 3-dimensional shape in space. This…
A: Amino acids are biomolecules that have an amino group, a carboxyl group and a side group that is…
In the chain elongation of proteins, the new aminoacyl-tRNA bonds to?
a.A site
b.E site
c.G site
d.P site
Step by step
Solved in 3 steps
- What site on the ribosome is the place where a tRNA molecule leaves the ribosome after attaching its amino acid to the growing chain of amino acids? a. E site b. P site c. A site d. the small ribosomal subunit Please respond as soon as possibleA particular tRNA is mutated so that the amino acid attachment cannot bind with the aminoacyl-tRNA synthase. What happens when an mRNA transcript contains the codon for this TRNA? O A. The tRNA will not bind to this codon. O B. Translation stops and the protein is released. O Č. The wrong tRNA is added to the protein chain. D. Translation stops and the protein remains bound to the ribosome. vered MacBook Air 80 F3 D00 D00 F4 F2 F5 % & 23Once a peptide bond has been formed between the amino acid attached to the TRNA in the P site and the amino acid associated with the TRNA in the A site, what process occurs next? a. translocation of the ribosome along the mRNA b. binding of a new tRNA in the E site C. scanning for the start codon d. release of the peptide from the TRNA
- tRNAs a. carry amino acids b. bind to the anticodon present in the mRNA c. adapt the genetic information to the ribosome d. catalyze the peptide bondThe codon UUU in an mRNA molecule which results in phenylalanine being inserted as the protein is made. Which will be a characteristic of this codon? a. The tRNA molecule that binds to the UUU codon must have an AAA anticodon. Nde ba e2? b. UUU could code for both phenylalanine and alanine during translation. c. The aminoacyl-tRNA synthetase for phenylalanine binds only the UUU codon. d. UUU is probably only one of several codons that code for phenylalanine.Which translation factor mediates the aminoacyl-tRNA entry into the A site of the ribosome? A. EF-Tu B. EF-Ts C. EF-G D. IF1
- Use the table to answer: A portion of an mRNA attached to a ribosome reads: 5′ GACCAUUUUGACAAAGUUGUAGUGUGGGUAGGGUGA 3′ If a tRNA with a Phe attached is in the P site of the ribosome, an uncharged tRNA will be present in the E site that delivered which amino acid? What is the last amino acid in this polypeptide? Which amino acid will be the most frequent in the polypeptide?In which site(s) of the ribosome could you find a tRNA with more than one amino acid bound (a peptidyl- TRNA)? a. In both the E- and P-sites. b. In both the A- and P-sites. С. Only in the A-site. d. Only in the P-site. e. Only in the E-site.Choose the answer that has these events of protein synthesis in the proper sequence. 1. A TRNA binds to the A site. 2. A peptide bond forms between the new amino acid and the growing polypeptide chain. 3. TRNA vacates E site as the next tRNA binds to the A site. 4. Both ribosomal subunits have bound, and the first TRNA is in the P site. 5. TRNA translocates to the P site, as upstream tRNA translocates to E site. O 4, 1, 3, 2, 5 ) 1, 3, 2, 4, 5 4, 1, 2, 5, 3 2, 4, 5, 1, 3 5, 4, 3, 2, 1
- The addition of the poly-A tail adds more than 200 units of adenine to the strand of mRNA, yet no protein has a continuous line of more than 200 phenylalanines in its structure. Why is this so? A. RNA splicing occurs and removes the noncoding sequences. B. The poly-A tail and 5' GTP cap do not translate into proteins. C. The adenines are reabsorbed by the cell and help to form other forms of RNA. D. The tRNA does not recognize the poly-A tail.What is the genetic code? a. The relationship between a three-base codon sequence and an amino acid or the end of translation b. The entire base sequence of an mRNA molecule c. The entire sequence from the promoter to the terminator of a gene d. The binding of tRNA to mRNAA particular tRNA is mutated so that the amino acid attachment cannot bind with the aminoacyl-tRNA synthase. What happens when an mRNA transcript contains the codon for this tRNA? A. The tRNA will not bind to this codon. B. Translation stops and the protein is released. C The wrong tRNA is added to the protein chain. D. Translation stops and the protein remains bound to the ribosome.