In DNA replication, the Multiple Choice determines what nucleotides are added to the new strand being synthesized. O bond between RNA polymerase and the exposed base O oxidation state of the phosphate group sugar found in the DNA nucleotides
Q: The initial rate (v0) data as a function of substrate concentration [S] for an enzyme (Enzyme1) that…
A: Enzymes kinetics - is the study of the reaction rate of enzyme catalyzed reactions. The reaction…
Q: What is something new you learned about function of proteins?
A: Proteins are large polymers made up of amino acid residues linked to each other via peptide bonds.…
Q: Chitin is a storage form of fuel in plant cells is the storage form of glucose in animals provides…
A: Biomolecules are molecules found in living organisms that play a role in their chemistry. They are…
Q: What are the objectives of a Nucleid Acid Extraction Experiment in Plant Leaves? Give 4
A: Nucleic acids are biomolecules that carry genetic information from one generation to another. Only…
Q: Which organisms below take part in the carbon and sulfur cycle? Explain their function in the…
A: Nutrient cycles ensure the supply of various nutrients and elements in the environment. Microbes and…
Q: How is the Citric Acid Cycle regulated, and how does this compare to glycolysis regulation?
A: The Citric Acid Cycle (also known as the Krebs cycle) is a series of enzyme-catalyzed reactions that…
Q: 1. outline the principles and procedures of isoelectric focusing. 2. Explain the four levels of…
A: As per the central dogma of molecular biology, DNA contains the code that is necessary for the…
Q: What are the differences in terms of structure and ligand-binding interactions? What are the…
A: GPCRs are a type of transmembrane receptor that consists of seven transmembrane helices that…
Q: 2. Of the molecules shown below, which one would you expect to inhibit chymotrypsin most…
A: Chymotrypsin is a digestive enzyme that is produced in the pancreas and plays an important role in…
Q: Select three products of recombinant DNA that are of value in the field of medicine. Tumor necrosis…
A: rDNA is a type of DNA that is artificially created by combining DNA sequences from different…
Q: Knowing that I is an inhibitor and A is an activator, discuss the relative values of k₂, k6 and ks.
A: Rate of a reaction is the product of substrate concentration and rate constant. For example,…
Q: Serotonin pathway of tryptophan transformation.
A: The conversion of biomolecules to one and another is a key feature of metabolism. This ensures the…
Q: In the traditional alkaline lysis method, what is the purpose of Solution 2? For what is its use?
A: Solution 2 is a critical component of the alkaline lysis method, as it provides the harsh conditions…
Q: Weak acids in water are _________________________ reactions. Weak bases in water are…
A: Weak acids in water are equilibrium reactions. This means that the weak acid partially dissociates…
Q: How can I Using the trendline equation, calculate the concentration of protein in the Unknown…
A: A standard curve is based on linear regression analysis. In linear regression, we examine whether…
Q: The phosphates that make up the phosphodiester bonds in DNA have pka 2. The genome of the blue crab…
A: pH is a measure of the acidity or basicity of a solution. It is defined as the negative logarithm of…
Q: Can you explain the process of beta-oxidation for saturated and unsaturated fatty acids, and the…
A: Fatty acids are building block of fats in our body and it constitute a carboxylic acid with an…
Q: Why are hydrogenases oxygen sensitive? Consult Morra, S. (2022), Fantastic [FeFe] Hydrogenases and…
A: Hydrogenases are enzymes that catalyze the oxidation and reduction of molecular hydrogen. They play…
Q: Can you please give me a little more detail on finding Ki? Where did the values come from? 0.23,…
A: Parameters such as Km and Vmax are used for comparing enzyme activities. If we know the initial rate…
Q: 2. In this lab, we will be performing a 1:2 dilution of 20mM ONPG. You will need 6mL.. mL of 20mM…
A: Dilutions are very important component of any enzymatic assay. Since enzymes are precious and are…
Q: (a) Fill in the blank regarding the mechanism of chymotrypsin below. (1) Polypeptide substrate binds…
A: Serine proteases are protein cleaving enzymes that have Serine, Histidine and Aspartate (the…
Q: What kind of protein is casein? POST-LABORATORY QUESTIONS: What is the isoelectric point of casein?…
A: Since you have posted a question with multiple sub parts, we will provide the solution only to the…
Q: Exercise 4. Write the formulas of the chemical compounds contained in the CHD.
A: Chemical compounds - quercetin, rutin, and avicularin are plant isolated flavonols and flavonoid.…
Q: What are the reagents found in a restriction enzyme digestion buffer? What are the roles of these…
A: Restriction enzymes are enzymes that recognise and cleave DNA at or near specific DNA sequences.…
Q: Discuss briefly the role of (a) 10% hydrochloric acid (b) 10% Na2CO3, and (c) anhydrous Na2SO4 in…
A: Alkaloids are a diverse group of naturally occurring compounds that are produced by plants, fungi,…
Q: An individual with chronic hypoglycemia was suspected of having a defect in one of the enzymes…
A: The observation that glucose production from glycerol is normal in the liver biopsy, but glucose…
Q: Regarding the glycolysis metabolic pathways covered in class: A. In the EMP metabolic pathway, what…
A: Glycolysis is a well known pathway that converts glucose to pyruvate. There are a series of…
Q: On the basis of their physical properties, hormones fall into one of two categories. One category,…
A: The mechanisms of hormone action differ due to their difference in solubilities. The hormones are…
Q: Molecular diameters of proteins IgG and TNFα are 11.2 nm and 4.4 nm, respectively. The diffusion…
A: Stokes-Einstein equation is the relationship between diameter and diffusion coefficient of a…
Q: 2. . Regarding the glycolysis metabolic pathways covered in class: A. In the EMP metabolic pathway,…
A: Glycolysis is the primary step of cellular respiration. Glycolysis or EMP (Embden–Meyerhof–Parnas)…
Q: Fatty acids can be gluconeogenic precursors in plants, but not animals. O True O False
A: Gluconeogenesis is a metabolic process that occurs in the liver and kidneys. It allows the body make…
Q: serotonin,y-aminobutyric acid, and dopamine are derived from different amino acids by just one or a…
A: Neurotransmitters are chemical messengers that allow neurons (nerve cells) in the brain and other…
Q: the amino acid proline has a net negative charge at Ph of 12 true of false
A: The isoelectric point (pI) of an amino acid is the pH at which there is no net charge on the amino…
Q: Create an illustrated step-by-step schematic diagram of the following Analysis of Lipids: Solubility…
A: Lipids are insoluble in water. They are soluble non-polar solvents like chloroform, benzene, etc. or…
Q: How would phrase the relationship between transmission and absorbance? And concentration and…
A:
Q: Fill in the chart below: Carbohydrate Protein Nucleic Acid Lipids HO H OH H H Circle one monomer in…
A: Carbohydrates, proteins , nucleic acids and lipids are the bio molecules. they are produced by…
Q: Before we finish this part of the Activity, you’re going to begin summarizing what you’ve learned…
A: Functional Group: A functional group is a reactive portion of a molecule that is responsible for the…
Q: Differentiate these two Insulin of Homo Sapiens First photo: gor4 prediction Second photo: phd…
A: Preproinsulin is composed of 110 amino acids, which becomes active by the removal of signal peptide…
Q: Respiration is related to how cells balance redox reactions in the metabolic pathway. It can be…
A: The respiratory quotient (RQ) is a measure of the ratio of carbon dioxide produced to oxygen…
Q: 7. Flow of carbon atoms. What is the fate of the radioac- tive label when each of the following…
A: Since you have posted multiple questions with multiple sub parts, we will provide the solution only…
Q: Shown below is Lineweaver-Burk plot for an enzymatic reaction at different substrate concentrations…
A: Enzymes kinetics - is the study of the reaction rate of enzyme catalyzed reactions. The reaction…
Q: Answer Bank Glyceraldehyde 3-phosphate + P¡ + NAD+ →→→ 1,3-bis 3-Phosphoglycerate →→→…
A: Glycolysis is the first phase in aerobic cellular respiration. It is the step during which one…
Q: Lysozyme is an enzyme that hydrolyzes bacterial cell wall…
A: Lysozymes are antibacterial agents that have the ability to hydrolyze the cell wall of bacteria. The…
Q: discuss the difference between ‘immunoreactivity’ and ‘bioactivity’.
A: Immunoreactivity and bioactivity are two terms used in immunology and biochemistry to describe…
Q: Consider the polysaccharide to the right? a) What is the linkage between the sugar units? b) Is…
A: Disaccharides are carbohydrates made up of two monosaccharide units linked together by a glycosidic…
Q: Which of the follwing enzymes adds incoming deoxyribonucleotid triphosphates to the 3' OH of the…
A: Deoxyribonucleotides or deoxyribonucleoside triphosphates (dNTPs) are the building blocks of DNA.…
Q: In the potato catalysts experiment on the left one at frozen potato and in middle room temperature…
A: Enzyme activity can be affected by various factors such as temperature, pH, substrate concentration,…
Q: How can the AGE process be improved?
A: Electrophoresis means the migration of a charged particle under the influence of an applied electric…
Q: What is the effect of omega 3 and omega 6 fatty acids on the metabolism of lipoproteins?
A: Biochemically, these fatty acids are polyunsaturated fatty acids that have multiple double bonds in…
Q: 1) Why is the GPCR referred to as a GEF? What would occur in G protein signalling if the Ga subunit…
A: This answer explains the concept of G protein-coupled receptors (GPCRs) and their role as guanine…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Describe in detail the semi Conservative replication of the DNA double helix structureDNA replication ATGGATCAGHTCCAGGGTACCCA what would the new strand look likeDNA replication occurs by adding (Note: NTPS = nucleotide triphosphates; dNTPs = deoxynucleotide triphosphates) DNTPS to the 3' end of the template strand NTPS to the 3' end of the daughter strand DNTPS to the 3' end of the daughter strand DNTPS to the 5' end of the template strand NTPS to the 5' end of the daughter strand
- Origin of replication [ Choose ] [Choose] Codon Complementary pairs with cytosine in a DNA molecule The site of protein synthesis Ribozyme This molecule can begin the synthesis of a polymer of nucleotides without a primer A short peice of lagging stand DNA Primase A reflection of redundancy in the genetic code RNA which exhibits enzymatic properties Okazaki Fragment The process of making RNA from DNA Helicase DNA polymerase Transcription Enzyme which lays down a segment of RNA on replicating DNA so that DNA nucleotides can polymerize A sequence of three nucletotides which codes for an amino acid Ribosome Point Mutation Chromosome Wobble Position The point on a stand of DNA where replication begins Mitochondria RNA polymerase [ Choose ] GuanineIn DNA Replication, what is the function of Primase: works to connect discontinuous parts of DNA such as the nicks created by gyrase and the okazaki fragments O Synthesizes RNA on a DNA template to provide an available 3'-OH group to continue with DNA synthesis O binds at the origin and begins to unwind the helix O bind near the origin to maintain the complementary sequences of DNA from reforming the helical structureDuring DNA replication, the function of RNA primers is to Group of answer choices serve as a binding site for DNA ligase separate the two strands of the double helix to open replication "bubbles" serve as starting points for DNA strand elongation by DNA polymerase in the 3' - 5' direction prevent new-separated strands of DNA from rejoining serve as starting points for DNA strand elongation in the 5' - 3' direction by DNA polymerase
- Polymerases work is to add 10 nucleotides to a DNA strand before dissociating. During replication process, DNA pol III can add tens of thousands of nucleotides at a moving fork. How this additionaccomplished?he bases of one of the strands of DNA in a regionwhere DNA replication begins are shown at the endof this problem. What is the sequence of the primerthat is synthesized complementary to the bases inbold? (Indicate the 5′ and 3′ ends of the sequence.)5′ AGGCCTCGAATTCGTATAGCTTTCAGAAA 3′DNA Replication For the following piece of DNA, draw the replicated piece of DNA show me where the original and replicated strands of DNA end up. A ATCCGTTACCCA A ACGATATC C GTTA AC C GC G ITAG GCA ATGG GTTTG CTATAG GCA ATTGG C G C
- Given a sequence of a DNA coding strand: 5’-ATGATTATCCTATAG-3’ What is the sequence and direction of the complementary DNA strand?DNA replication Which of the following does not occur during DNA replication? Belect an answerand submit. For keyboard navigation, use the up/down arrow keys to select an answer. One new molecule is formed by continuous synthesis while the other new molecule is formed in fragments. DNA molecules unwind from each other. Cellular processes proofread new molecules to check for errors. P. Two daughter molecules are formed for each template strand. Unanswered கறறenentary bases lWhich protein is needed to lay down a segment of RNA complementary to the DNA before replication can begin? O RNA pelymerase NI O primase O helicase O DNA polymerase lII O topoisomerase