Answered: In a string, we can have repeated…

In a string, we can have repeated pattern. Example: Input abc Output none abaa none (a) 4 (ab) 2 (abc) 2 (ab) 2 (ababac) 3 aaaa abab abcabc ababacababac ababacababacababac

C++ for Engineers and Scientists

4th Edition

ISBN:9781133187844

Author:Bronson, Gary J.

Publisher:Bronson, Gary J.

Chapter9: Completing The Basics

Section: Chapter Questions

Problem 3PP: (Program) Write a C++ program that accepts a string from the user and then replaces all occurrences...

See similar textbooks

Related questions

Q: ython implements Newton's algorithm for finding the square root of a number using recursion NOTE:…

A: square of a number using recursion:-

Q: cci series begins with the terms 0 and 1 and has the property that each succeeding term is the sum…

A: Start Now declare variables i, b, c, fib we will initialize the variables b=0, c=1 and fib=0 Enter…

Q: You, Alice and Bob are working on recursive search algorithms and have been studying a variant of…

A: Bob has heard that trinary search is no more efficient than binary search.

Q: Write a program to enter a natural number n and find all sphenic numbers from 1 to n using Recursion…

A: Write a program to enter a natural number n and find all sphenic numbers from 1 to n using Recursion…

Q: Given a list of integers, we want to know whether it is possible to choose a subset of some of the…

A: For Problem Statement, We have to find subset sum from the list in Java. Given non-negative…

Q: ally marks are an example of a numeral system with unary encodings. A number n is represented with…

A: The given problem is related to string manipulation with the recursion mechanism. The solution needs…

Q: The Fibonacci series begins with the terms 0 and 1 and has the property that each succeeding term is…

Q: Euclid’s algorithm (or the Euclidean algorithm) is an algorithm that computes the greatest common…

A: Solution:

Q: You, Alice and Bob are working on recursive search algorithms and have been studying a variant of…

A: I will explain it in details,

Q: The following code implements Newton's algorithm for finding the square root of a number using…

A: Input : n = Number g = inital guess of square root e = permissible error Output : Tuned value of…

Q: You, Alice and Bob are working on recursive search algorithms and have been studying a variant of…

A: Sol:-- Bob has heard that tinary search is no more efficiant than binary search. Bound select a…

Q: 1. Consider the following program: (a) What is the recurrence relation? T(n)= if n l: Algorithm int…

A: For question number a, T(n) = 1, if n<=1 Explanation - As it is returning 1 in the base case so…

Q: Let n be a positive integer and suppose we identify a collection of n people with numbers ranging…

A: The above question is solved in step 2 :-

Q: The following function f uses recursion: def f(n): if n 0 a <- a + i + (i-1) return a c) def…

A: Given: The following function f uses recursion:def f(n):if n <= 1return nelsereturn f(n-1) +…

Q: Given an array of strings, return all groups of strings that are anagrams. The groups must be…

A: Using the below python code, the certain array of string can be grouped separately based on the…

Q: The following code is supposed to return n!, for positive n. int factorial(int n){ if (n == 0)…

A: We are given a code which is suppose to be the logic for finding the factorial of positive number n.…

Q: Given a list of integers, we want to know whether it is possible to choose a subset of some of the…

A: public static boolean canMakeSum(ArrayList<Integer> list, int sum) { if(sum==0)…

Q: Euclid's algorithm (or the Euclidean algorithm) is an algorithm that computes the greatest common…

Q: The Sudoku game is played on a 9x9 grid. Inside the rows and columns are 9 "squares" (made up of 3x3…

A: Every row, column, and sub-matrix (3x3) contains each digit from 1 to 9. Thus, we can also conclude…

Q: C++ wrtie an algorithm that inputs an even positive number N and outputs the 10 even numbers…

A: Here is Your Code #include <iostream> using namespace std; int main(){ int n,count=0;…

Q: What does the ff. algorithm return? (Note: indentation is important) algorithm foo(a1, a2, ..., an :…

A: We are given an algorithm and we are going to find out what is the logic of the code and we are…

Q: You, Alice and Bob are working on recursive search algorithms and have been studying a variant of…

A: Introduction : Trinary search is a decrease and conquers algorithm that can be used to find an…

Q: 3 4 6 7 8 N: number of elements in array A x: integer number 2: integer number z) return true return…

A: Answer: The algorithm traverses the array at-least for once to count the occurrence the best case…

Q: We can express insertion sort as a recursive procedure as follows. In order to sort A[1..n], we…

A: Given: We can express insertion sort as a recursive procedure as follows. In order to sort A[1..n],…

Q: (Poor Person's Logarithm) For this question, we will be given a number x and a base b and will find…

A: Below is the code in C++ and sample output:

Q: Given an input string, delete recursively all the duplicate adjacent characters and return a string…

A: Algorithm: Start Implement a method named delDuplicate() that takes a string s as an argument…

Q: The reverse of a string x denoted by rev(x) and is defined by the following recursive rule:…

A: A is regular, so there exists a DFA M accepting A. Now, let's construct an NFA N from M as follows.…

Q: A palindromic number is a number that is the same if read forwards or backwards: 12321 and 641146…

A: Important:- As per our guidelines, we are allowed to answer only the first three questions of…

Q: Can u do a recursive function of this code Question How can i make this recuraive function in…

A: #include<iostream>using namespace std; void recursivePattern(int a,int n){ int space,d;…

Q: nput: S ( a set of integers), m ( an integer) output: All finite subsets of S that sum to m 1. List…

A: I attached your answer below.

Q: Suppose you are given a vector x. Write first a pseudo-code or algorithm that would print out the…

A: Note:- since python is programming language that is mentioned in the question. In python array or…

Q: The following function f uses recursion: def f(n): if n 0 a <- a + i + (i-1) return a c) def f(n):…

A: The Fibonacci sequence is a series of numbers where a number is the addition of the last two…

Q: Give a recursive algorithm that takes as input a string s, removes the blank characters and reverses…

Q: A formula for finding the greatest common divisor (GCD) of two numbers was formulated by the…

A: Given : Values of a and b. Output : GCD of a and b using recursive function.

Q: Problem: If n is a positive integer, then n factorial (written n!) is the product of the numbers…

A: Program code: #define recursive function to calculate factorial of a numberdef factorial(n): #if…

Q: The following code is supposed to return nl, for positive n. An analysis of the code using our Three…

A: Objective: A recursive algorithm for computing the factorial of a value is stated. We need to check…

Q: r, (adapted from the 2012 ICPC programming competition) Write an algorithm to solve the following…

A: Solution PFB algorithm for problem resolution:

Q: Write an algorithm that takes a vector of integers A[1..n] and an integer x and, in O(n log n) time,…

A: Assume the array is sorted. For finding the first element, use linear search: Time complexity is…

Q: Let n be a positive integer and let MaxCrossing(n) be a function that returns the maximum number of…

Q: Given a list of integers, we want to know whether it is possible to choose a subset of some of the…

A: Coded using Java.

Q: Given below is a recursive algorithm to compute r". The input r can be any real number. The input n…

A: Here in this question we have given recursive algorithm to compute r^n.and we have asked to complete…

Q: Write a function "sumofEven" that takes an int "n" and returns the sum of all even integers starting…

A: We have to write a function "sumOfEven" to find sum of even numbers from 1 to n we have given sample…

Q: The Sudoku game is played on a 9x9 grid. Inside the rows and columns are 9 "squares" (made up of 3x3…

A: in the above sudoku game is not right ,when we compile we get error in line col_vars =…

Q: The following function f uses recursion: def f(n): if n 0 a <- a + i + (i-1) return a c) def f(n):…

A: The given recursive function calculates nth fibonacci number. Option a would have been correct if…

Q: This algorithm lists the number of strings formed from the symbols in set D (defined below) of…

A: Since we are dealing with one string at a time and printing them, the length of the string doesn't…

Q: Count divisibles in range

A: Note: The provided solution is correct as per the question requirements. If you need further…

Q: To practice implementing recursive algorithms Directions For this practice problem, you will…

A: We need to write a Java program to find all anagrams of a word. The idea is to generate all…

Q: The following Python program solves Sudoku using backtracking. The method that starts the solution…

A: In 9 x 9 sudoku Time complexity depends on : Explanation: 1.if in the sudoku has one empty spot so…

Q: Given an input string, a non-empty substring subs, and a non-negative number n, compute recursively…

A: Code works perfectly. I am providing code in java. Please use proper indentation for no error.…

Concept explainers

Computational Systems

The computation systems can be defined as the systems that are capable of solving a problem that includes calculations either mathematical or logical, and are able to produce the result as an output. For example, a simple calculator that is given a set of numbers and operators as input and produces the result as an output can be defined as a computational system. The above example is a simple illustration only, the computational systems range from simple devices to complex devices such as the systems that control the SpaceX companies, Starlink satellites which are being quite recently seen in the skies at many places globally.

Question

The problem:
➢ Input: a string in a line.
➢ Output: Print the pattern and the repeated count if there is a repeated pattern, Print "none"
otherwise.
➢ Task: Design an algorithm in pseudocode/code to for the problem and write down the
Algorithm analysis. The complexity of the algorithm must be in O(n).

In a string, we can have repeated pattern. Example:
Input
Output
abc
none
abaa
none
(a) 4
(ab) 2
(abc) 2
(ab) 2
(ababac) 3
aaaa
abab
abcabc
ababacababac
ababacababacababac

Process or set of rules that allow for the solving of specific, well-defined computational problems through a specific series of commands. This topic is fundamental in computer science, especially with regard to artificial intelligence, databases, graphics, networking, operating systems, and security.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, computer-science and related others by exploring similar questions and additional content below.

Similar questions

--------. Given a string s, find the length of the longest substring without repeating characters. Example 1: Input: s = "abcabcbb" Output: 3 Explanation: The answer is "abc", with the length of 3. Example 2: Input: s = "bbbbb" Output: 1 Explanation: The answer is "b", with the length of 1..
Write in C Language Spilitology Yosef is a peculiar fellow. He introduced the idea to study a string by splitting it into two, and he called it Splitology. Why split a string? We do not know. Didn’t we say that Yosef is a weird one? Yosef is interested in one particular type of string, a palindrome. A palindrome is a string that is the same for both forwards and backwards. Example of palindrome strings are “ada”, “taat”, and “radar”. On the other hand, string such as “taman” is not a palindrome; notice that “taman” becomes “namat” if read backwardsand it’s not the same as “taman”. As the idea of Splitology is still new, Yosef is investigating whether a string can be split into two non-empty strings such that each string is a palindrome. For example, the string “malamini” can be split into “malam” and “ini” while both of them are palindrome. Another example is “ababab”. It can be split into “aba” and “bab”, and both of them are palindrome. Note that “ababab” can also be split into…
2 - Arrange string characters such that lowercase letters should come first. Example: input: PyNaTive output: yaivePNT
Draw a DFA that accepts strings that do not contain two consecutive a's or two consecutive b's. Here, Σ = {a,b}. e.g. aba, bab, ababa, bababa, etc.
A lapindrome is defined as a string that, when split in the middle, gives two halves with the same characters and the same frequency of each character. If there is an odd number of characters in the string, we ignore the middle character and check the lapindrome. For example, gaga is a lapindrome because the two halves of ga and ga have the same characters with the same frequency. Also abccab, rotor and xyzzy are some examples of lapindromes. Note that abbaab is NOT a lapindrome. Both halves contain the same characters, but their frequencies do not match. Your task is simple. You have to figure out if it's a lapindrome by looking at the string. Note: Please Answer in Python Only Input 1 gaga Output YES
A hexadecimal string is a finite sequence of the digits 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, A, B, C, D, E, F. (In particular, a hexadecimal string can have leading 0’s.) How many hexadecimal strings start and end with the same character?
111111 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 count_E=s.count('E') 20 count_e=s.count('e') 21 count_res= count_E + count_e 22 print('Count: ', count_res) 23 24 A string containing a text is given. Find the number of words starting with the letter "e". Text example: Ezheviku dlya ezhat Prinesli dva ezha. Ezheviku ele-ele Ezhata vozle eli ş'eli. (7 words) ### s = "Ezheviku dlya ezhat "Prinesli dva ezha." \ "Ezheviku ele-ele" \ "Ezhata vozle eli s'eli."
Given one Input String and Pattern Library as follows: Input Strings:TATTTCTGGTCCACCTGATTAATAAGCTTCCTCTACAA TAGAATTTGTCAGGTAGGAATGTGTGTAGACTATAAAGGTCCATGTGTGTAGACTATAAAGGTCCTCACTTCTCTTTATCTACCCT Pattern libraries:TGCGATATGTGAAAGCCTCTAAGG Searching for a pattern in an input string can be done with a certain algorithm and by using the aho-Corasick string-matching algorithm, several patterns at once in the library can be detected in an input string.How to make a finite state machine for the pattern library above?
In a string, we can have repeated pattern. Example: Input Output abc none abaa none aaaa (a) 4 abab (ab) 2 abcabc (abc) 2 ababacababac (ababac) 2 ababacababacababac (ababac) 3 The problem:➢ Input: a string in a line.➢ Output: Print the pattern and the repeated count if there is a repeated pattern, Print "none"otherwise.➢ Task: Design an algorithm in pseudocode/code to for the problem and write down theAlgorithm analysis. The complexity of the algorithm must be in O(n).➢ PS: You use the algorithm for string matching taught in class. The repeated pattern is valid onlyfrom the first character.
(Program) Write a C++ program that accepts a string from the user and then replaces all occurrences of the letter e with the letter x.
Let Σ= {Ac,BA,bcb,cd,ab,d,i}. Find the length for the given below strings dbcbdBAAcdabdab BAdddabBAAcdbcbab bcbidbcbiAcibcbiii Note: factorize each string for finding their length (only mentioned length will be marked ZERO) If we have Σ = {aaD, cbb,bc} then find it’s Σ+ & Σ* Design an NFA that accepts Language contains at least one instance of 0010, 111 or 01010.
Write a regular expression that defines strings that have an even (but nonzero) number of "a" characters followed by an odd number of "b" characters. For example, aab, aabbb, aaaab, and aaaabbb should all match the regular expression.