II. Making your Master Mix and PCR Set up for TPCN2: Note: the reaction volumes will be 20 µL and n = 10 reactions! Assume you extract gDNA quantitated by the NanoDrop at a concentration of 1065.7 ng/μL. Calculate the dilution(s) needed to get to a concentration of 25 ng/μL needed for making your Master Mix. Show pipettable volumes! Do two-step dilution.... Show work.
Q: ased off the information given, complete the table a. What mode of inheritance pattern best fits…
A: A pedigree represents the genetic family history of an individual. It is made of symbols and lines…
Q: Complete the following table correctly regarding the number of PAIRS of antennae usually found in…
A: Antennae are the sensory appendages found in various arthropods, including insects, crustaceans, and…
Q: Which statement is NOT TRUE regarding abortion in the U.S. today? a)The vast majority of abortions…
A: The objective of the question is to identify the statement that is not true about abortion in the…
Q: After digesting the DNA produced by PCR (generated using the primers mentioned in question 2 added…
A: DNA (deoxyribonucleic acid) is a molecule that contains the genetic instructions for building and…
Q: Determine the CFU/ml of the original culture in the image below. Write your value in scientific…
A: Serial dilution is a process by which a sample with an unknown concentration is used to calculate…
Q: Genes a and b are 20 cM apart. An a+ b+/a b individual was mated with an a b/a b individual. which…
A: Recombinant progeny are the result of crossing over during meiosis, which allows for the exchange of…
Q: How can we write an introduction of API20E ? An overview of enterics - the microbiota within the…
A: The API 20E system is a powerful tool in microbiology, specifically designed for the identification…
Q: a. Firmicutes Firmicutes Panels (a) and (b) shown depict two scenarios for the distribution of the…
A: The question asked is about microbiota, the community of microorganisms that live in and on our…
Q: With what does the duration of action of insulin preparations (short-, intermediate-, and…
A: Insulin is a hormone produced by the pancreas in the human body. It plays a crucial role in…
Q: What are the different types of vertebra based on the shape of centrum?
A: Vertebrae are the individual bones that make up the vertebral column, also known as the spine or…
Q: Sordaria fimicola is often used to demonstrate arrangement of colored ascospores within an ascus…
A: Sordaria fumicola is an ascomycetes fungus that is used to study the crossing over and recombination…
Q: 10) Normal individuals Affected Individuals O Fill in the genotype in each circle and box using the…
A: By the Pedigree shown in the figure first of all we need to know what is the inheritance pattern by…
Q: In the rocky intertidal zone, two barnacle species are found, one low down in the wet zone and the…
A: The ecological niche of a species is the role it plays in its environment. It includes all of the…
Q: Which of the following is a/are true characteristic(s) of RNA? RNA is partially formed of…
A: Ribonucleic acidRibonucleic acid, or RNA, is a key component of the living cell. It is the genetic…
Q: A 42 year old man is admitted to the hospital with the sudden onset of dyspnea with clear lungs and…
A: The patient is 42 years old and has been conceded to the hospital due to sudden onset dyspnea, or…
Q: 11 10 8 123 6 5 6. Describe the pathway (ducts) that a sperm cell would travel from its production…
A: The human reproductive system is a complex system of organs that work together to produce offspring.…
Q: What is garbology? Define what this is and why it is important as a field of discipline. Minimum 2…
A: Garbology is the study of modern refuse and trash. As an academic discipline, it involves the…
Q: Which of the following is not a term used to describe an unspliced mRNA? intronic mRNA O primary…
A: In eukaryotic genes, non coding DNA is also present. In most of the eukaryotic genes, coding…
Q: 1) Draw chromosomes as an X or /, not decondensed. 2) Since we are focusing on the DNA, do not draw…
A: IntroductionMeiosis is a type of cell division that produces gametes (sperm and egg cells) with half…
Q: Covalent modification of eukaryotic DNA is an important regulator of gene expression. Name one type…
A: Covalent modifications can be described as a alteration in the activity of enzyme, DNA and protein,…
Q: Part 1: Make a three part process drawing (like a cartoon strip) to demonstrate Mendel's Principle…
A: An allele is a variant form of a given gene. Phenotype is the observed physical traits of an…
Q: What controls the movement of the lungs? Describe the flow of air into the lungs. Use the following…
A: Respiration is the process of exchange of gases ( oxygen and carbon dioxide) in which cells take up…
Q: In your own words, explain how genetic ancestry testing works. (Minimum of 2 complete sentences.)
A: Genetic ancestry testing, also known as genetic genealogy, is a method for people interested in…
Q: Solve the problem below : Two white-flowered strains of the sweet pea were crossed, producing an F1…
A: When two white-flowered strains of sweet pea were crossed, the F1 generation produced only purple…
Q: Can you explain the answers and the advanatges of the Lineweaver-Burk Graph vs. Michaelis-Menten?
A: The Lineweaver-Burk graph and the Michaelis-Menten graph are both graphical representations of the…
Q: Match the tissue shown with its function. option: 1. Present in bone marrow, spleen, and lymph…
A: Tissues are groups of cells that work together to perform a specific function. In the human body,…
Q: Identify this tissue. Select one: a. Epithelial, simple, squamous b. Epithelial, simple, cuboidal…
A: In the image we can see the elongated cells and the image of part of alimentary canal including…
Q: For the following sets of partial diploid bacteria, is the Z gene constitutive, inducible, or…
A: An inducible gene is a gene that can be turned on or off in response to specific signals or…
Q: What are the differences in plasma glucose contents, plasma β-hydroxybutyrate contents and plasma…
A: Normal Feed Rats: In rats that are regularly fed, plasma glucose levels are typically within a…
Q: A bacterial culture is grown using either octadecane (C18H38) or pentachlorophenol (C6HOCI5)) as the…
A: Bacterial cultures play a crucial role in biodegradation processes, utilizing specific substrates…
Q: The plant pigments extracted in the virtual lab that were water soluble were determined to be in…
A: The question at hand involves understanding where water-soluble plant pigments are located within a…
Q: Which of the following is a/are false characteristic(s) regarding DNA? A. DNA can be found in…
A: DNA is the genetic material which is responsible for transferring the genetic information from one…
Q: Experiment to test how one of the following variables impacts the growth of Brassica rapa: Water,…
A: These four variables are thought to control the growth of Brassica rapa - water, nutrient…
Q: In your own words, explain one of the following results that happened after a population went…
A: The question is asking for an explanation of the biological and physiological changes that occurred…
Q: Which of the following classes includes the only type of echinoderm that has a calyx on a stalk?…
A: The phylum Echinoderms comprises marine animals that are distinguished by their spiny skin, water…
Q: I am testing the prediction that spiders with colors that match a flower (cryptic coloration) will…
A: A research study involves experimentation and observation of variables to establish valid…
Q: What is wrong with the following statements: (a) "OK, we'll do an audit program, but we can't…
A: There are different statements regarding to various conditions and there are some flaws in each…
Q: Match the tissue shown with its function. option:
A: The given figure shows the simple columnar epithelial tissue. These are the single layer of cells…
Q: Order: acetaminophen (Tylenol) 80 mg PO Q4H PRN fever Patient 20.5 kg; 6 years old Supply: 80 mg…
A: Tyelenol is the drug that is taken for fever and pain relief. Correct dosage of any drug should be…
Q: Match the specific dinosaur character/feature to its most correct dinosau by pulling down to the…
A: Anterior facing/pointing pubis bone: This characteristic is associated with dinosaurs of the…
Q: Compare the 95% confidence interval for the difference between two true means with the 95%…
A: Confidence intervals are essential tools in statistics for estimating the range within which a true…
Q: For a lab on diffusion and osmosis, where a egg yolk was placed in a cup water the following…
A: The movement of water inside an egg yolk is influenced by the principles of osmosis. Osmosis is the…
Q: explain Tibetan genetics pertaining to high-altitude living and give me a brief summary of how it…
A: The question is asking for an explanation of the genetic adaptations that have allowed the Tibetan…
Q: Identify this tissue. Select one: a. Epithelial, simple, squamous b. Epithelial, simple, cuboidal…
A: Tissue is a historically derived biological organizing level in biology that lies between individual…
Q: Discuss the Eupnea, Dyspnea, Hyperpnea, Apnea, Orthopnea
A: The lungs and respiratory system allow us to breathe. They bring oxygen into our bodies that is…
Q: 5' GTATGTTACGTAACCTCTGCCTGCTAAGGGTAGAATATAGCTACGCTATCGATGGTAGCTAGCGATCG 3' a b с 29) Examine the…
A: This question asks to identify the binding site for the transcription factor TFIID in a given DNA…
Q: Select all the statements from the answer bank that are true regarding cyanobacteria. They gave rise…
A: Cyanobacteria are also referred as blue-green algae. These are the group of photosynthetic bacteria…
Q: To what class does this animal belong?
A: Reptilia encompasses a mix of reptiles—snakes, lizards, turtles, and crocodiles. Triceratops, the…
Q: Define biological determinism and explain how the classifications of humans that resulted from this…
A: Biological determinism, also known as genetic determinism, is a theory that suggests the genetic…
Q: What are the components that make up the endocrine system? What are each of their functions? How do…
A: The endocrine system is a complex network of glands and organs that produce and secrete hormones,…
Please help me do this step by step.
Step by step
Solved in 3 steps with 3 images
- Kpnl 4. Plasmid Z has a size of 7 kb, and the map shows Kpnl (K) and Pstl (P) cut sites relative to each other. This plasmid was digested with three different restriction enzymes 2000 bp 3500 bp Kpnl (K), Pstl (P) and Bgll (B) either alone or in combination and the samples run on an agarose gel as shown below. Where does Bgll (B) cut this plasmid ? Does the plasmid have one recognition site or two for Bg|l? Describe the Bgll cut site in this plasmid relative to the Kpnl cut Plasmid Z -7 kb Pstl site. How many bases to the left or right of the Kpnl cut site would you observe the Bgll cut site. Explain briefly. 1500 bp Pstl Ladder Kpni Psti K/P Bgl K/B KPB 7000 bp 7000 bp 5600 bp 5500 bp 4900 bp 3500 bp 2000 bp 1500 bp 1500 bp 1500 bp 1400 bp 600 bp %3DYou have another circular plasmid. Complete and effective digestion of this plasmid with a restriction enzyme yields three bands: 4kb, 2kb, and 1 kb. In comparing the band intensity on an ethidium bromide-stained gel, you notice that the 4 kb and the 2 kb bands have the exact same brightness. The 1 kb band is exactly one fourth as bright as each of these. (Assume there is uniform staining with ethidium bromide throughout the gel.) How many times did the enzyme cut the plasmid? What is the size of the plasmid? Justify your answers to a and b above using a clearly labeled diagram showing the relative location of the cut-sites on the plasmid.Please answer this asap. Thanks, You have discovered a new plasmid RK21 in a unique bacterial community. As a first step towardunderstanding this plasmid, you digest the plasmid with three restriction enzymes: SspI, XhoI andSmaI. You run the digested plasmid DNA on an agarose gel, along with an uncut sample of theRK21 plasmid DNA as a control.Unfortunately you forget to load a DNA ladder, and obtain the following results. Assumecomplete digestion of all samples or all the digests worked completely
- DNA Isolation A. What is “cell lysis” and why would you want to lyse cells when doing a DNA extraction? B. What do the “proteases” like meat tenderizer do to the DNA? C. What two ingredients help precipitate the DNA out of solution?4. Look at the gel image and answer the questions below and be specific. a) Based on your calculations of the DNA concentrations, how much DNA was loaded into each well? Do you see DNA for each of your samples? If not, why do you think that is so? b) Is the DNA in a single sharp band, multiple bands or a smear? What would each of these scenarios be due to, and why would you see them for your samples? c) Do you see multiple bands in your plasmid DNA sample? What are they?Why is the company Qiagen has more refined DNA extraction steps than a normal Strawberry DNA extraction practical? Summary of Qiagen DNA extraction steps Add ATL buffer and grind with sample. Add 20 microliters of enzyme Proteinase K to degrade protein into a 1.5-2ml microcentrifuge tube. Add 200 microlitres AL lysis buffer, and mix by vortexing for 5–10 seconds, which breaks cell membrane allowing DNA to be released. Incubate the sample at 56 degrees for 10 minutes. Mix the cell lysate with 200 microlitres ethanol by pipetting it at the side of the microcentrifuge wall so DNA precipitates. The DNA forms a white layer and the remaining liquid is discarded. Pipet the mixture into DNeasy Mini spin column placed in a 2 ml collection tube. Centrifuge for a minute at 8000 rpm. Place the mini spin column into a 2 ml collection tube, add 500 µl Buffer AW1, and centrifuge for 1 min at 8000 rpm. Then add it to a new 2 ml collection tube (provided), add 500 µl Buffer AW1, and centrifuge for 1…
- Can you please help with 1b please. picture with 1 graph is for question 1a) picture with 4 graphs is for question 1b) 1a) E. coli DNA and binturong DNA are both 50% G-C. If you randomly shear E. coli DNA into 1000 bp fragments and put it through density gradient equilibrium centrifugation, you will find that all the DNA bands at the same place in the gradient, and if you graph the distribution of DNA fragments in the gradient you will get a single peak (see below). If you perform the same experiment with binturong DNA, you will find that a small fraction of the DNA fragments band separately in the gradient (at a different density) and give rise to a small "satellite" peak on a graph of the distribution of DNA fragments in the gradient (see below). Why do these two DNA samples give different results, when they're both 50% G-C? 1b) If you denatured the random 1000 bp fragments of binturong DNA that you produced in question 1a by heating them to 95ºC, and then cooled them down to 60ºC…DNA Extraction by Alkaline Lysis Procedure: 1. Spin 1.5 ml of cells in a microcentrifuge at maximum speed (12,000 rpm) for 20s to pellet. Remove the supernatant completely with a Pasteur pipet or a plastic pipettor tip. The spins can be performed at FC or at room temperature. Longer spins make it difficult to resuspend cells. 2 Resuspend pellet in 100pul GTE solution and let sit 5 min at room temperature. Be sure cells are completely resuspended. 3. Add 200ul NaOH/SDS solution, mix by tapping tube with finger, and place on ice for 5 min. 4. Add 150ul potassium acetate solution and vortex at maximum speed for 2s to mix. Place on ice for 5-15 min. Be sure mixing is complete. 5. Spin 3 min at 12,000 rpm to pellet cell debris and chromosomal DNA 6. Transfer 0.4 ml supernatant to a fresh tube, mix it with 0.8 ml of 95% ethanol or 0.4 ml isopropanol, and let sit 2 min at room temperature precipitate nucleic acids. 7. Spin at 12,000rpm for 3 min at room temperature to pellet plasmid DNA and…1) Prepare the following enzymatic reaction, present it in tabulated form. In a final volume of 30 ul, where buffer 4 (10 ml). How much volume of each reagent would be used and how much of water? Is there any problem? 2) The DNA pol 1 enzyme comes at a concentration of 50,000 U/ml. You have to prepare a 50 ug PCR reaction where you must use 0.05 U/ml reaction. You add 10 ul of PCR buffer, 2 ng of tempered DNA that is at a concentration of 0.5 ng/ul, primers (which are at 200 mM) so that each one remains at a concentration of 200 uM, Mg+2 that is 5 mM (10 X), enzyme and water. Present the table of all the reagents included in the reaction, the volumes of each one in ul. Present where the initial and final concentration of each reagent applies. Assume you have micropipettes for all values.
- PCHEM4321. An agarose gel electrophoresis pattern of the plasmid PSPM4321 digestion (restriction) is shown below. Draw a restriction map of a plasmid with the appropriate restriction sites based on the data given below. Hindlll Hindll BamHI +BamHI Figure 1: 1% agarose gel electrophoresis of pCHEM4321 40 24 16 12 12 8 4 4 + |3 Step3: After you have prepared the 3 diluted plasmid samples and the master mix, you can now use them to prepare the individual PCR reactions. For example, to prepare 25 μl PCR reactions for sample A, you need to combine, J ul of "diluted plasmid sample A", and M ul of "master mix". Repeat this step for all 3 reactions, then you can start the PCR reaction in the thermocycler. Solve for J and M.Note: Answer the number 3 question only. Explain. 1. What is the Difference between DNA Purification and RNA Purification? 2. why contaminants must be avoided in DNA samples? 3. Give 5 examples of sources of error in using a spectrophotometer.