If a metabotropic (GPCR) receptor is activated, all of the following can occur except for Opening of a G protein-gated ion channel. Changes in gene expression. Opening of an ion channel within the receptor. Changes in the levels of a second messenger.
Q: 1.Where will a bacteria grow best: glucose, malonate, or gluconate? Explain your answer…
A: Culture media is a gel or liquid that contains nutrients and is used to grow bacteria or…
Q: List some genera of free-living and symbiotic nitrogen-fixing bacteria.
A: Nitrogen-fixing bacteria are microorganisms that convert nitrogen gas from the atmosphere into a…
Q: Did studying genetics help you change your perspective about what a human is
A: Genetics It refers to the study of genes and heredity. Heredity refers to the passing of genetic…
Q: The amount of sodium in Bowman's capsule can be doubled by: O A. Doubling of glomerular hydrostatic…
A: Introduction The Bowman's capsule, a component of the nephron, creates a sack that resembles a cup…
Q: Can you show me a picture of raspberry and banana clade and explain
A: The monophyletic clades are those group of organisms that have a single clade in it.
Q: 1. Write down the 5-digit code for this organism. 2. What is the name of the device used to get this…
A: Microorganism identification is a crucial aspect of many microbiologists' work. For example,…
Q: What hormones are involved in renal functions, and what 2 systems, ultimately what affects water…
A: The kidneys assist in maintaining the body's fluid balance by filtering the blood. Small tubules in…
Q: Cytotoxic T Cells attack O pathogens, rapid growth and division O pathogens, apoptosis (cell death)…
A: Introduction Immunity is defined as the ability of the body to fight against the pathogens. There…
Q: In classical Mendelian genetics, how can one check the genotype of a parent (A) expressing the…
A: Allele can be defined as an alternative form of gene.Dominant allele is an allele which hides the…
Q: A student determined the Km, Vmax and turnover number (kcat) for an enzyme by performing reactions…
A: Km is a constant for a given enzyme and is therefore independent of the enzyme concentration.…
Q: What role does the environment play in addressing the needs of society?
A: The environment is a physical area where living things communicate with its non-living elements.…
Q: What's the large medial area of the chest? explain in detail
A: The space between the pleural sacs of the lungs that runs the length of the thoracic cavity is known…
Q: Please match the junction type with the cytoskeletal component it is associated with Desmosome Tight…
A: Different cells' plasma membranes contain structures called cell junctions. Animal cells include…
Q: Fund the KT Boundary Layer Found the DNA structure Found the DNA shape Described Natural Selection…
A: Evolution is the gradual change in the inherited traits of biological populations over many…
Q: D Question 12 Anaphase involves the: Re-forming the nuclear envelope de-compaction of chromosomes,…
A: Answer and explanation - Anaphase -segregation of sister chromatid. Other charaters- chromatid move…
Q: Regarding the analysis of single marker STR results used in forensic science. Tick all the correct…
A: The true statements among the given statements are: If a suspect's alleles are different from those…
Q: Which of these would be a first line of defense against microbial infection?
A: Ans : Our immune system has three lines of defense to fight against microbial infection. Those are :…
Q: B. Next you isolate DNA from colonies and cut the DNA with the restriction enzymes you chose from…
A: A. As the plasmid contains ampicillin resistance gene, therefore, it confers resistance to amicillin…
Q: When you cross a female carrier for Color Blindness XCXc with a Color Blind male XcY, what is the…
A: An imbalance in how one or more light-sensitive cells (known as cones) located in the retina of the…
Q: A hypothetical gene for cephalosporin resistance is found to be carried by a transposon. Explain…
A: The three primary modes of antimicrobial resistance are (1) enzymatic breakdown of antibiotics, (2)…
Q: Myosin, a motor protein that interacts with actin to drive muscle movement, is bound to a phosphate…
A: Proteins are highly essential for the body to provide in maintaining structural and functional…
Q: Explain why infections caused by fungi, protozoans, and helminths are more difficult to treat than…
A: Introduction : Infection is the entry of the pathogen or infectious agent that causes the disease…
Q: In this activity, you will: 1. Observe life forms other than those you studied from Grades 3 through…
A: This activity is about different types of living beings. Living beings carry out various life…
Q: The human body has structures that could be considered the product of “unintelligent design” (i.e.…
A: Organisms are never perfectly designed or adapted. In reality, "perfection" cannot be found in…
Q: which of the following is NOT a possible source of the monomer building blocks in the RNA world…
A: RNA world hypothesis assumes the formation of early living beings which uses RNA as genetic…
Q: Use the following information to answer the next question. The DNA strand shown below is thought to…
A: DNA ( deoxyribonucleic acid ) is two stranded , helical structure which act as genetic material in…
Q: can you please label on the image i have provided
A: The nucleus is present within the cell and constitutes chromosomes. Connective tissue is responsible…
Q: Give a brief explanation of natural selection that includes all the necessary components for it to…
A: Natural selection is the process through which a population of living things adapts and evolves.…
Q: show me what the clade of banana and grape would look like
A: The term clade is associated with a collection of all the living and extinct members of that…
Q: Based on the change to the nucleóti How did this mutation change the amino acid sequence of the…
A: A mutation is the term that describes change seen in the sequence of nucleotides that may…
Q: List down 10 warm-up exercises for badminton. Specify by Name of exercise , counting, target…
A: Warm-up exercises can help to prepare the body for physical activity by increasing blood flow to the…
Q: About 70 percent of all Caucasians can taste the chemical phenylthiocarbamide, and the remainder…
A: There is present single gene in the population. These are T and t. TT and Tt encode taster…
Q: Label each part of the figure in the 4 spaces provided
A: In the diagram catalysis is shown. Catalysis is carried out by various enzymes which speeds up the…
Q: Describe the virulence factors of H. pylori that allow it to colonize the stomach and survive…
A: Gastritis is a stomach lining inflammation produced by damage to the mucosal layer to prevent the…
Q: The figure below shows differential methylation patterns for various genes in samples of 2 embryonic…
A: The process by which methyl groups are added to the DNA sequences is called DNA methylation.…
Q: Assume that the length of wheat leaves is controlled by three loci, each with two alleles: L and I,…
A: A trihybrid cross is a type of cross in which three traits are involved. As per the question ,…
Q: A vaccine that employs a toxoid is based upon a ______. A) antibody B) attenuated virus C) histamine…
A: A vaccination is a pharmacological substance that enhances a person's resistance to specific…
Q: transcribe and translate the following using the codon chart: DNA TAC CCC AAG CTC GGT ATC
A: During transcription, C is replaced with G, G with C, T with A and A with U. Also, tRNA contain…
Q: Which of the following is part of the extracellular matrix? A) All of the other answers are correct…
A: The fundamental building block of all living things is the cell. The trillions of cells that make up…
Q: Select all of the following traits that are quantitative (check all that apply) growth rate in mice…
A: Quantitative trait is specific features which are identified by multiple genes. This is also…
Q: In mammals, individuals with two X chromosomes usually de-activate one of the X chromosomes inside…
A: The cell has two kinds of chromosomes. These are sex chromosomes and autosomes. There are two sex…
Q: DNA is alway DNA mRNA 5' aal 3 51 PROMOTER AACGCATACGGGATAGCGCCCTGGTTCAAATGGCGGGCCGGCATCCC…
A: One of the core concepts of molecular biology is the flow of information from DNA to RNA to…
Q: frequencies for a single gene with two alleles for three different populations.…
A: According to Hardy Weinberg equilibrium equation- p2 + q2 + 2pq =1 and p + q =1 Where, p =…
Q: What materials used for bioprosthesis heart valves (the chemically pretreated heart valves)?
A: Prosthetic valves are used to replace diseased or non-functional or dysfunctional heart valves. It…
Q: 1a) Name the start codon and the three stop codons for translation. 1b) What amino acid is…
A: An mRNA codon is a triplet or triple-nucleotide sequence that codes for a certain amino acid during…
Q: Discuss how histologists can use visualization of epithelial tissue to help with diagnosis of…
A: Note: Sorry, as per the honor code we are not allowed to cite external sources. Thank you!…
Q: Explain how ALS leads to physiological symptoms
A:
Q: Assume two alleles A1 and A2 with known frequencies e.g. p (A1) = 0.7, q (A2)= 0.3 What would be…
A: There is single gene. It has two alleles: A1 and A2. The allelic frequency of A1: 0.7 The allelic…
Q: The response. B cells, humoral O T cells, humoral produce antibodies as part of the O macrophages,…
A: Introduction: Immune system component known as an antibody that circulates in the blood and lymph in…
Q: WHAT LEVEL OF ORGANIZATION? Identify each image as either an atom, organism, organelle, molecule,…
A: The levels of organisation given in this image from smallest to laregst are: Atom, molecule,…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Outline the three general means by which binding of a water soluble extracellular chemical messenger to its matching surface membrane receptor brings about the desired intracellular response.Which of the following statements most accurately describes what happens when an antagonist binds to a receptor? The antagonist binds non-covalently to the receptor and promotes internalisation of the receptor. Antagonist binding alters the structure of the receptor making it unable to function normally. At sufficiently high concentrations the antagonist can prevent the receptor from binding to its natural (endogenous) ligand. The antagonist-receptor complex binds to a heterotrimeric G protein forming a stable and inactive ternary complex.Arrange the following in correct order in which G-protein coupled receptor systems are activated: Drug Receptor Protein kinase A Adenylyl cyclase G-protein Cellular response
- Which of the following is the best description of how a G protein coupled receptor responds to a ligand binding? O Binding of ligand to the receptor causes the G protein to swap out GTP for GDP Binding of ligand to the receptor causes the G proteins to dimerize and trigger cross-phosphorylation Binding of ligand to the receptor causes the G protein to become activated, then the G protein travels through the plasma membrane to activate an enzyme Binding of ligand to the G protein triggers it to swap out GDP for GTP, causing it to become activated OOO OWhich of the following ion channels are always electrosensitive? stress-activated channels ligand-gated channels with extracellular ligands voltage-gated channels ligand-gated channels with intracellular ligands all of the aboveWhich of the following is most likely an example of signaling through a transmembrane receptor? The influenza virus recognizes specific proteins on the surface of host cells, causing the entrance of genetic materials into the cytoplasm of the host cells. Low-density lipoproteins (LDL) bind to receptor proteins found on the membrane of receiving cells, triggering its internalization into the receiving cells. The binding of interleukin-6 (IL-6) to the interleukin-6 receptor causes the activation of protein kinases in the cytoplasm, activating the transcription factor NF-κB. The binding of aldosterone to the aldosterone receptor activates its transcription activity, leading to the transcription of genes that promote the uptake of ions and water.
- Name three features common to the activation of cytokine receptors and receptor tyrosine kinases. Name one difference with respect to the enzyme activity of these receptors.A metabotropic receptor Is a G protein coupled receptor May activate ion channels All of these May activate second messengersThe figure below shows a signaling pathway activated by the bindiıng of adrehalMNe LU the beta-adrenergic receptor. Binding of adrenaline to the receptor causes GTP-binding and activation of G proteins. Active GTP-bound G protein activates adenylate cyclase to initiate a signaling cascade that affects cellular responses, and includes cellular changes to mediate increased heart rate and accounts for the flight-or-fight response. activated adenylate cyclase adrenaline activated B-adrenergic receptor adenylate cyclase G protein subunit 22 GTP SDP conformational ATP CAMP change in receptor heterotrimeric G protein ACAMP inactive protein kinase A active protein kinase A 4 cellular responses Consider the homozygous mutation in which a cell produces a variant of adenylate cyclase that can no longer be activated Which of the following are true in this cell? Select all that apply. Heart rate increases Protein Kinase A is not activated CAMP levels are lower than normal Heart rate decreases
- What term is used to indicate signaling chemicals that bind to membrane receptors? Which type of membrane receptor is most important in directing intracellular events by promoting formation of second messengers?Which of the following types of amino acids may never be found in the transmembrane sections of G-protein coupled receptors? Alanine Arginine Valine None of the aboveClassify each phrase as describing ligand-gated ion channels, voltage-gated ion channels, or both. Ligand-gated ion channels a form of passive transport Voltage-gated ion channels include the acetylcholine receptor change conformation in response to changing membrane potential Answer Bank may participate in an action potential Both change conformation in response to a signal molecule binding