Identify the principle (what amino acid/s it detects and the general reaction), the reagents used, the procedure (list down the procedures) and the expected results (interpretation of results) for each of the tests below: 4. Lead-Sulfide Test Principle b. Reagents Required c. Procedure Expected Results
Q: Given the following coding strand sequence of DNA, what is the template strand sequence?…
A: Nucleic acids are biomolecules that are essential for all life forms. They are polymers of…
Q: What is the abbreviated name of the human gene that contains the CAGATTGTGAAGAGGTCTCTTGA? following…
A: Nowadays there are various tools that are used in bioinformatics to find out the gene from the gene…
Q: (ii) Shown below is a section of a canonical TFO. Discuss, in detail, chemical modifications that…
A: Triplex forming oligonucleotides (TFO) are single stranded homopyrimidine/homopurine oligonucleotide…
Q: The genetic code is said to be degenerate. This means that each codon codes for more than one amino…
A: INTRODUCTION: Genetic code - The genetic code is defined as the set of rules or instructions which…
Q: The question is not being answered for either of them. What is the maximum ATP including converting…
A: Electron Transport Chain (ETC) located in the inner mitochondrial membrane, consist of four protein…
Q: An N-linked glycoprotein contains a glycan covalently linked to which specific amino acid in a…
A: N linked glycosylation is the process in which an oligosaccharide molecules are attached to proteins…
Q: Give a detailed account of the tricarboxylic acid pathway and how it is regulated in eukaryotic…
A: The citric acid cycle (CAC), sometimes referred to as the Krebs cycle and the tricarboxylic acid…
Q: Which of the following is NOT a zymogen? A) Chymotrypsinogen. B) Proelastase. C) Enteropeptidase.…
A: Zymogens are inactive form of enzymes that upon successful cleavage and processing are converted to…
Q: What does an area of clearing indicate in biochemical test?
A: Measuring a nutrient or its metabolite in the blood, faeces, urine, or other tissues that have a…
Q: 1. Isoelectric focusing. A digested protein sample was applied to one end of a gel strip with an…
A: Isoelectric focusing is a technique used to separate proteins on the basis of their isoelectric…
Q: FRET is a widely used biophysical technique for the characterization of a wide range of biomolecular…
A: FRET is a unique method for measuring the separation between a donor-acceptor pair of chromophores.…
Q: Experimental results describing a protein's amino acid composition are useful for estimating the…
A: Proteins are high molecular weight polymers of amino acid residues linked together via peptide…
Q: Cell signaling systems: A. autocrine B. paracrine C. endocrine D. none among the…
A:
Q: (c) Outline how you would investigate whether BCMAP would be an effective inhibitor for the protein…
A: Inhibitors are the molecules that slow down or completely block the protein activity of molecules,…
Q: C) using Fischer Projection, draw each for the payoff phase of glycoly in 6.) G13 P 1, 3-bPG 3) 3PG…
A: Glycolysis is the collection of 10 enzymatically catalysed reactions that sequentially oxidises a 1…
Q: Match the following steps of oxidative phosphorylation in increasing order from beginning (1) to end…
A: Oxidative phosphorylation is the process by which oxidation of NADH and FADH2 by the complexes in…
Q: rue or false 1. Cytochrome p450 is considered to be the “universal oxygenase” 2. In alzheimer’s and…
A: Oxygenases are enzymes that oxidise substrates with molecular oxygen. PD and AD are neurological…
Q: Provide a simple sketch of the covalent intermediate likely to form between active site serine…
A: Serine, histidine, and aspartate all are amino acids. They all have different properties and…
Q: Serine proteases are involved in the control of blood coagulation, fibrinolysis, complement…
A: Serine proteases - are enzymes which cleaves peptide bond by formation of catalytic triads and Ser…
Q: Sugar Molisch's Solution Test Glucose Sucrose Lactose Hydrolysis: Samples Sucrose hydrolysate Starch…
A: Qualitative tests are used to determine for the presence or absence of any substance in the given…
Q: Enzymatic Saccharification Saccharomyces cerevisiae/Turbo Yeast Preparation of Fermentation Saba…
A: Saba peels are the banana peels that are often regarded as waste. Turbo yeasts are a special strain…
Q: 3. Please draw the core structure of Lignan, and numbering the C-atoms.
A: In 1948, Haworth first introduced the term "Lignan", which are also subgroup of non-flavonoid…
Q: give an example of how signal transduction plays a role in disease
A: Introduction: Our human body undergoes various processes to coordinate individual cells to support…
Q: Which of the following does NOT correctly describe the fluid mosaic model of lipid bilayer? A.…
A: Lipids are biomolecules that do not have a fixed chemical structure like carbohydrates or amino…
Q: what is the classification and biosynthetic pathway for the following: geoghin HO OH
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: Complex 2 oxidizes ___ and reduces __ a. FAD, COQ b. COQ , Cytochrome C C NADH, COQ d.…
A: Aerobic metabolism of 1 molecule of glucose can produce 10 NADH (6 from acetyl CoA in TCA cycle + 2…
Q: Which of the following are the precursors in synthesizing myristic acid? a. 7 malonyl-CoA b. 3…
A: Myristic acid is a common fatty acid. It has 14 carbons. Its molecular formula is CH3(CH2)12COOH. It…
Q: How are soaps made? Draw the full saponification reaction between potassium hydroxide and a…
A: Lipids are one of the 4 biomacromolecules. Majority fraction of a lipid molecule would be…
Q: 1. What constitutes the backbone of a nucleic acid? _ 2. Give the base sequence of the complementary…
A: Nucleic acids are organic molecules that act as the genetic material, and store and transfer genetic…
Q: What is the total number of H+ transferred from matrix to intermembrane space of the mitochondria by…
A: Complex I, II, and III are the part of the electron transport chain or oxidative phosphorylation.…
Q: RUE OR FALSE 1. Abzymes reduce rotational entropy. 2. Hammerhead ribozymes have the ability to bind…
A: Enzymes are catalysts acting inside the living system to reduce the reaction time and speed up the…
Q: how ecstacy affects the brain?
A: 3,4-methylenedioxy-methamphetamine which is commonly known as MDMA or Ecstasy is a syntheic drug. It…
Q: PLEASE HELP 1. How many chirality centers does ribose have? Identify them.
A: Chirality is a property that is exhibited by molecules that cannot be superimposed on their mirror…
Q: What charge does a protein molecule have? O neutral O positive O negative O The charge depends on…
A: Diffusion and osmosis are 2 processes that depict the movement of substances from higher…
Q: RC B H₂N-C- C A B H This content is protected and may not be shared, uploaded, or distributed. C A D…
A: Amino acids are the building blocks of protein. Structurally they contain compounds such as carbon,…
Q: E. coli replication on the lagging strand O is carried out by DNA polymerase I O is initially…
A: In E. coli genetic information is stored in form of DNA. E. coli DNA is circular in shape. DNA…
Q: Subunit Composition of a Protein. A protein has a molecular mass of 400 kDa when measured by…
A: Size exclusion chromatography is a technique which separates molecules according to their size…
Q: Mutations within this gene CAGATTGTGAAGAGGTCTCTTGA are causative of which human diseases? A.…
A: The nucleotide sequence provided corresponds to the XPA gene of humans. This is deduced by doing a…
Q: All metabolic pathways must be regulated to maintain homeostasis. The catalytic activity of an…
A: Enzymes are biocatalysts that catalyse biochemical reactions. They contain an active site where the…
Q: Calculate length of tubes required for desired production rate
A: Proteins Proteins are the long chain of amino acids , they are essential for the structure,…
Q: Calculate hematocrit for Susie's whole blood sample, given the following information: RBC volume =…
A: Introduction Whole blood is composed of erythrocytes (RBC), platelets and leukocytes (WBC). The…
Q: To completely reduce an oxidized cytochrome-c, how many electrons are required?
A: The electrons transport chain is a collection of four protein complexes: complex I, II, III and IV…
Q: Carnitine combines with fatty acids groups to form acyl carnitine through carnitines ____ group…
A: Beta oxidation of fatty acids takes place in mitochondrial matrix. For this, first the fatty acids…
Q: In the synthesis of urea, one nitrogen atom comes from ammonia, the other comes from: ○ A) fumarate.…
A: The urea cycle (or ornithine cycle) is a cycle of biochemical reactions that produces urea from…
Q: Age-related macular degeneration (ARMD) within the eye is a disease that is closely related to…
A: Age-related macular degeneration (ARMD) is an ocular disease causing damage to the retinal macula,…
Q: Why does the lack of carnitine causes hypoglycemia, muscle weakness? Justify the answer…
A: INTRODUCTION : Hypoglycemia : It is a disorder or condition in which the levels of the body's blood…
Q: A patient receives an intravenous (IV) solution that flows at the rate of 150 mL per hour. How…
A: The intravenous solution is the fluids or any medicine that is directly given into the vein. It…
Q: 9. In pre-historic earth, where there exist no protein enzyme, ribozymes (ribose enzymes) seems to…
A: The most significant molecules in cell biology are deoxyribonucleic acid (DNA) and ribonucleic acid…
Q: 1 Draw the following polypeptide: Met- Tyr-Val-Ser-Asn 2A Draw the hydrolysis of a dipeptide…
A: A peptide is a chain of amino acids, in which the amino acids are joined together through peptide…
Q: 2. Energetics of the electron transport. In the oxidative phase of oxidative phosphorylation,…
A: Standard change in Gibbs free energy (∆G'0 ) of redox reactions can be found, if we know the…
Direction: Answer thoroughly and explain.
Step by step
Solved in 4 steps
- Answer the following questions (not more than 5 sentences/question). Discuss the correct laboratory technique in using the centrifuge for qualitative analysis. Give two tips on its proper use. Explain how calcium ions are confirmed present in a solid salt by using flame test. Discuss a method to confirm the presence of a) phenol and b) ketone in a test compound. How are proteins confirmed present in a sample? Explain the laboratory process.Define D-dimer test and how to interpret the test. The reference range is in the table below Test Result (reference range) D-dimer, ng/mL FEU > 4000 (< 500)Demonstrate the procedure for arriving at the answer. A. It is necessary to carry out baths with Amitraz 12.5% in a batch of 25 patients. The product label says to dilute 1.5 ml of the product in 1 liter of water, for this there is a 50-liter water tank to prepare the product. Each patient corresponds to 1.2 L of the product diluted in water for an effective treatment. Calculate: a) total ml of amitraz needed to make the dilution in the water tank. b) ml of the product for each patient. c) Total ml of diluted Amitraz for the batch of patients. Answer: R: a) 75 ml. b) 1200 ml. c) 30.000 ml (Ctrl)-
- Suggest one reason why syringes are used in vitamin C content of food anddrink investigation rather than burettes. THE ANSWER HAVE TO BE AS SHORT AS POSSIBLE!A sample from a 65-year-old man was brought tothe lab at 9am from a private clinic. Serumpotassium is 8.5 mmol/L. The test was repeatedand the same result is obtained. All laboratorychecks have been carried out and the result isanalytically valid. The doctor is called via telephoneand he reveals that the sample was taken at 4pmthe previous day by the nurse. a) Comment on the value of potassium obtainedb) What could possibly be the cause for such resultsobtained?c) What course of action would you recommend?The table below summarizes the results for Ninhydrin test. Provide the correct remarks from the results if it's either Positive for Ninhydrin test or Negative for Ninhydrin test. and if it's Positive for α-amino acid or Negative for α-amino acid.
- Show workflow process of producing a Liquid Dosage Form through Extemporaneous CompoundingUse diagrams (boxes and arrows) to signify stepwise and significant procedures.https://www.youtube.com/watch?v=rKng5-ij6kQ Provide a schematic diagram for the Molish test methodologies in determining the presence of carbohydrates. Also, give the basic principle for the test. (not a graded question, the video is very brief) (please take time to answer)Explain the chemical basis (reaction) of Millon’s test. (Generic reaction and explanation) What is the difference between Millon's test and Biuret test?(minimum 5)
- The table below summarizes the results for Lead-sulfide test. Provide the correct remarks from the results if Negative for Lead-sulfide test or Positive for the Lead sulfide test and it's either Negative for -SH or Positive for -SHmake the test principle, materials required for the analysis, sample preparation, test procedure, indication of a positive result, complications/interferences, for nitrous acid test.Analysis of the pathological constituents GIVE THE FOLLOWING: - Name of Test/Test Reagent - Positive Result 1) Protein (Note: Presence of protein in urine is termed as proteinuria or albuminuria) A. Heat and Acetic acid test Fill a test about ¾ full of urine. Heat the upper portion gently to boiling for 1 -2 minutes being careful not to shake the tube. Rotate the tube to prevent overheating. A turbidity may be due to albumin, phosphates or carbonates. Add 3 drops of acetic acid drop by drop while boiling between each drop. If turbidity disappears, it is due to carbonates and phosphates. B. Heller’s nitric acid test Place 1 ml of urine sample in a test tube. Hold the test tube in an inclined position and carefully pour 1 drops of conc HNO3 down the side of the test tube. Note formation of white ring at the zone of contact of the two solutions which is an indication of the presence of protein.