Q: All of the following describe a gamete, EXCEPT: a) sperm b) haploid c) zygote d) egg
A: Gametes are an organism's reproductive cells. They are also referred to as sex cells. Female gametes…
Q: Q4.8. Which statement below is TRUE about the voltage-gated Na* channels during the action…
A: Voltage gated Na+ channels :- It play an important role as a regulatory for cellular excitability.…
Q: You are checking a calculation that a foundation pharmacy student has performed. The question asks…
A: 120 suppositories weighing 1 gram are to be made, containing 300mg Zinc Oxide. The displacement…
Q: Biology When both parents are heterozygous carriers of the recessive allele that causes albinism,…
A: Drew Binsky - World's Most Famous Albino
Q: Armadillos spend a lot of time digging in soil to find insects and plant roots to eat, as well as to…
A: Digging is considered as a major type of activity in armadillos life because its their habit to dig…
Q: 1. What are the characteristic of the mating systems of rheas?
A: DISCLAIMER As per guidelines, you have asked multipart questions, so we will solve the first…
Q: Natural selection means that the environment favors survival of some genotypes. From where does…
A: Natural selection can also give certain people a reproductive edge over others. Natural selection…
Q: Sensory receptors for the kinesthetic senses are located in the thalamus. embedded in the small…
A: Introduction - Sensory receptors are specialised cells found near neurons or neuron endings that…
Q: The critical stages when irrigation is needed are during the flowering or early fruiting stage and…
A: Introduction Irrigation is the process of applying water to the crops artificially through various…
Q: All herbivore species are small such as insects and would not be able to have massive muscular…
A: * Herbivores are organisms that feeds on plants and they can range in size from tiny insects like…
Q: iscuss the intestinal phase of gastric secretion regulation with examples
A: The digestive system is involved in a variety of processes, including food digestion and nutrient…
Q: 1 what is the Kel4tionshi gallstahes ahd Pheumohia?
A: Gallstones are classified as very tiny, hard crystalline masses that are generated improperly in the…
Q: Mark has an autosomal recessive condition called sickle cell anemia, a serious blood disorder that…
A: Sickle cell anemia is an autosomal recessive disorder which ne it can only expression if present in…
Q: You are studying energy production and metabolic activities of prostate cancer cells in the lab. You…
A:
Q: What is the nucleolus?
A: The nucleolus which is the region present inside the nucleus of a cell and they plays important role…
Q: Which of the following classifications represents the ecological level with the greatest diversity?…
A: The population, community, ecosystem, and biosphere are all levels of organisation in ecology. All…
Q: Species richness quantifies the amount of money each species is valued at on the biodiversity stock…
A: Species richness quantified?
Q: Having a widows peak is dominant W to not having one (ww) Having attached earlobes is a recessive…
A: Introduction Dominant traits are those phenotypic characteristics or properties which are inherited…
Q: Match the subfamilies of HSPGS withe their examples v syndecans and CD44V3 A. GPI-linked…
A: Proteoglycans are mucoproteins which are formed by glycosaminoglycans that are covalently attached…
Q: A beneficial dominant mutation is expected to take fewer generations to reach high frequency than a…
A: There are few important points: A population genetics is the study of changes in the frequencies of…
Q: Which of the following statements is true when considering this figure? It represents natural…
A: ANSWER) (f) all of the above are true. The bottle full of marble and and the jar represents the…
Q: Question 33 RNA polymerase II: A is located in the nucleoplasm and transcribes the protein-encoding…
A: Transcription is the process which is required for formation of mRNA from template strand of DNA.
Q: Do genes or alleles independently assort?
A: The alleles are the alternative forms of a gene that are located on the same locas of a homologous…
Q: Blood is stained with stain. a) Methylene blue b) Safranin c) Leishman stain d) Carbol fuchsine
A: Introduction - A blood smear, also known as a peripheral blood smear or blood film, is a thin…
Q: Select all that apply about 02 and CO2. O Both are nonpolar molecules. Both can diffuse passively…
A: 1) Both O2 and CO2 are the non polar , uncharged molecules which passes through the membrane by…
Q: Question 8 Why is replication called semi-conservative? A not all leading strands are conserved B…
A: During DNA duplication, is the method to copy DNA stands when new cells are formed.
Q: what are the steps in cellular organelles?
A: Organelles are the small structures within the cytoplasm that carry out functions necessary to…
Q: ain also.
A: Jawless fishes are about 100 species. Bony fishes are about 58% if all species so, they are the…
Q: TACTGCCTCCCCATAAGAATT
A: Transcription is the process in which a gene's DNA sequence is copied (transcribed) to make an RNA…
Q: Compare the cells in the two photomicrographs below in terms of their shape and structure(s). А B
A: *pictomicrographs shows the photograph of objects under a microscope. * objects like metal and…
Q: Question 2: Is it just a regular cold or COVID-19? Compare and contrast the two infections. In your…
A: Within the twentieth century, the globe suffered pandemics. The pandemics, as horrifying and lethal…
Q: Question 44 The term RNA refers to RNA. Blank 1 Blank 1 Add your answer
A: INTRODUCTION Answer to the question 44 is given below.
Q: The describes the situation where the gene pool of a population is determined by the genetics of a…
A: "Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: What is the nucleolus?
A: Introduction :- The nucleolus' primary role is to facilitate ribosome biogenesis by digesting and…
Q: The number of Microorganism A was exposed to a constant temperature of 117 C surviving spores of the…
A: D value is decimal reduction time and is described as time needed at a particular temperature for…
Q: Which of the answer choices is true about ATP synthase? Select all that apply.
A: ATP synthase is a transport protein. ATP synthase is an integral membrane protein.
Q: The fact that some eukaryotic rRNAs are self-splicing indicates that A RNA structures are highly…
A: In eukaryotes, rRNA have a sigma factor which makes the self splicable and hence the highly variable…
Q: What are the external anatomy of a cat and its function? 2. What are the external anatomy of a…
A: Answer
Q: 19 Across DOwn 1 Enzyme that "glues" Okazaki fragments together 4 Base that will pair with Thymine 5…
A: DNA replication is the process of producing complementary DNA from the parental DNA molecule.
Q: Give two assumptions for the Mendelian Inheritance for Segregation and Independent Assortment…
A: A central assumption of Mendel laws of inheritance is that genes originating from maternal and…
Q: Which sentence accurately describes the International Classification of Diseases (ICD) O It focuses…
A: *ICD means International Classification of Disease. It provides method of classifying diseases and…
Q: The eukaryotic transcription factor that exhibits a sequence specificity for the TATA box is: A)…
A: Transcription is the first step in the gene expression which transfers the genetic information…
Q: A strictly fermentative bacterium produces ATP A. by glycolysis only. B. by photosynthesis only. OC.…
A: Introduction The process of respiration can be aerobic or anaerobic. The process of anaerobic…
Q: Is there any interaction between the peptides given below with their single letter abbreviations in…
A: Proteins are made up of amino acids that are linked together by peptide bonds. Usually, in the cell…
Q: 6. Initiators of what enzyme start the destruction of the apoptotic pathway(s) in a cell? A.…
A: Apoptosis is a natural biological process of planned cell death in which cells destroy themselves in…
Q: Question 7: How could immunotherapy be used to kill superbugs and how would this therapy distinguish…
A: The immune system checks the body for infections or problem-causing chemicals and fights any harmful…
Q: 12. Below is a diagram of a cell. Which of the following is true? a. The cell is a plant cell,…
A:
Q: We are not usually consciously aware of our blood glucose levels because: O Information about blood…
A: * Nervous system divided into two main parts that is central nervous system (CNS) peripheral…
Q: A transition mutation would be replacing A by
A: Transition mutation is a process in molecular biology and genetics where it refers to point in…
Q: An enzyme that acts as both a kinase and phosphatase in rxn. of 1 uM 1,3-bisphosphoglycerate,…
A: An enzyme that adds phosphate groups (PO43) to other molecules is known as kinase. Kinases are…
How do mRNA levels correspond with
Step by step
Solved in 2 steps