how can one identical can be affected with a defect while the other is not

Q: What do restocking programs for wild animals involve?     Releasing individuals…

A: Restocking programs for wild animals involve a variety of strategies aimed at increasing the…

Q: Using the Pythagorean theorem, either with or without the formula proposed by Archimedes, calculate…

A: The objective of the question is to calculate the area of a right triangle using the given lengths…

Q: to produce four aughter cells. If a nondisjunction of an autosome happens during meiosis I, what are…

A: Meiosis : In this type of cell division a parent cell is divided into four genetically different…

Q: Drag the correct label to the appropriate bin to identify the type of cartilage that forms each body…

A: Identify the type of cartilage that forms each body structure.Hyaline CartilageElastic…

Q: Mutation #3 DNA template: 3' TA CGCGCTGCACGATGCAGTAGTACATC 5' mRNA transcript sequence: Amino acid…

A: Mutation #3:DNA template: 3' TA CGCGCTGCACGATGCAGTAGTACATC5'mRNA transcript sequence: 5' AU…

Q: Microscopic examination of a section of a normal young adult ovary reveals large numbers of…

A: The question is asking us to identify the phase of the cell cycle in which the large cells found in…

Q: Mike Henry Violet Iris Saul Paul Fiona Lilly Lucas Lucy Bob Ava Casey Dan Legend Female Male Male w/…

A: Pedigree charts are like a family tree and are used to trace the heridity of a trait through…

Q: using cysteine, serine, and aspartic acid create a tripeptide by performing 2 dehydration synthesis…

A: Structure:Amino Acid 1: Cysteine          Structure: H₂N–CH(CH₂SH)–COOHAmino Acid 2: Serine…

Q: Briefly introduce what ecosystem services riparia provides

A: Riparian zones, also known as riparian areas or buffers, are the transitional areas between land and…

Q: Categorize the following density-dependent factors by their cause and effect. The four categories…

A: The objective of this question is to categorize the given scenarios into four categories based on…

Q: Which of the following logical statements takes the form of an Aristotelian syllogism? if all…

A: The objective of the question is to identify which of the given logical statements fits the form of…

Q: why do large animals eat so low on the food chain

A: The question is asking why large animals, such as elephants or whales, tend to eat lower on the food…

Q: how can having extra copies of x or y chromosomes create genetic problems?

A: The objective of the question is to understand how having extra copies of X or Y chromosomes can…

Q: what mechanism, during evolution, is most likely to have arisen

A: During evolution, the mechanism most likely to have arisen is natural selection. Natural selection…

Q: Dimples are a dominant phenotype, determined by one gene with two alleles (D, d). From data obtained…

A: The Hardy-Weinberg principle explains that allele and genotype frequencies remain constant from…

Q: The diagram shows a liver lobule. Long-term destruction of the hepatocytes, collapse of the…

A: The question is asking about the potential consequences of long-term damage to the liver lobule,…

Q: Is current number of species always the same or very close to average number of species? If not,…

A: No, the current number of species on an island is not always the same or very close to the average…

Q: Why tablet compression is necessary? Please answer at your own easy words.

A: The objective of the question is to understand the importance of tablet compression in the…

Q: Your animal cell culture laboratory suddenly suffered from a bacterial contamination. Several…

A: B. The media is probably contaminated with Mycoplasma, due to the lack of cell walls they are the…

Q: Trophic Cascade Concept Map  Primary Producers: Include at least two different types of primary…

A: Trophic Cascade Concept Map Primary Producers:Grass (Plant):Herbivores:RabbitGrasshopperAlgae…

Q: Which of the following sites contains striated muscle that is not under voluntary control? A.…

A: A soft tissue that found in both animals and humans is called muscle.  It is made up of actim and…

Q: Which of the following is an example of virus-encoded molecules modifying signal transduction…

A: The best example of virus-encoded molecules modifying signal transduction pathways to promote…

Q: Which statement about the relationship between genetic map and physical map is FALSE? The…

A: Genetic Map: A genetic map, also referred to as a linkage map, illustrates the relative positions of…

Q: Microscopic examination of a PAS-stained histological section through a Graafian follicle…

A: The objective of the question is to identify the correct term that describes the acellular ring…

Q: What is the primary reason for why pulse pressure increases with aging? a. Decrease in the number…

A: The objective of the question is to identify the primary reason for the increase in pulse pressure…

Q: Aristotle’s use of the syllogism is best illustrated by which of the following statements? if the…

A: The objective of the question is to identify which of the given statements best illustrates…

Q: 2. After being bitten by a poisonous snake, a patient will receive a mixture of antibodies against…

A: The treatment described involves the use of antivenom, which contains a mixture of antibodies…

Q: Two cultures of a facultative anaerobe are grown in the same medium, but one culture is exposed to…

A: Facultative anaerobes can live with or without oxygen. They prefer to live in aerobic condition, but…

Q: 6. The banding patterns of the DNA fragments within the gel reveal that.. child 1 and child 2 cannot…

A: During DNA testing, the banding patterns are observed as it shows whether the individuals share a…

Q: In the adult, neurons are an example of which of the following? A. Continuously dividing cells B.…

A: The question is asking to identify the type of cells that neurons in an adult belong to. The options…

Q: How would you design an experiment to determine whether elephants can detect and interpret the calls…

A: The objective of this question is to design an experiment that can test whether elephants can detect…

Q: Describe the steps by which the transport of electrons down the respiratory chain leads to the…

A: Oxidation of NADH The NADH and FADH2  produced in the glycolysis, and citric acid cycles are first…

Q: Which of the following is NOT true about cis-regulatory elements (CREs)? Group of answer choices…

A: Non-coding DNA sections called cis-regulatory elements (CREs) control the interpretation of…

Q: A gastric biopsy is taken from a 42-year-old man. As the pathologist inspects the specimen, he…

A: The objective of the question is to identify the region of the stomach from which the biopsy was…

Q: How tablet compression should be done? I mean what is the best time for it?

A: The objective of the question is to understand the process of tablet compression and to determine…

Q: There are various parameters to assess microbial growth. What are some microbial growth curve…

A: The normal pattern of development that bacteria and other microorganisms display when cultivated in…

Q: 9 7 13 14 20 20 2 6 3 110 15 16 16 S 11 12 17 18 19 19 22 23 33 15 22 21 21 27 27 28 24 29 30 30 25…

A: Within the study of evolutionary science, one critical aspect is the timing of significant occasions…

Q: 1. A new species of animal called the rekamriliob has been found in the wild. The lab you work in…

A: Explanation: Since the genes for coat color (P/p) and limb thickness (T/t) are unlinked, they…

Q: Given the allele frequencies below, what would be the expected genotype frequencies in the next…

A: The link between genotype and allele frequencies in a population is described by the Hardy-Weinberg…

Q: A recent field experiment examined how the genotype at one locus affected the fitness of trident…

A: In evolutionary science, the concept of fitness is central to understanding how hereditary variety…

Q: Which of these statements about carbonic anhydrase is incorrect? Question 17Answer a. It…

A: The objective of the question is to identify the incorrect statement about carbonic anhydrase, an…

Q: What is the normal range for RBC, Hgb, HCT, WBC, and Platelet and their relevance to a patient with…

A: Blood is a thpe of fluid connective tissue made of different kinds of blood cells. These blood cells…

Q: Which of the following is true about the pacemaker potential in the heart? a. Decreased K+ efflux…

A: The pacemaker potential, also known as the prepotential, is the slow, positive increase in voltage…

Q: The leukocyte pictured above stains intensely with acidic dyes such as eosin. Which of the following…

A: The question is asking about the substance that is contained in the crystalline core of the granule…

Q: Using the Pythagorean theorem, either with or without the formula proposed by Archimedes (or by…

A: The objective of the question is to calculate the area of an isosceles triangle using the…

Q: Describe the mechanisms contributing to excitability changes in the dorsal cochlear nucleus of the…

A: Tinnitus, the perception of ringing or buzzing in the ears without an external sound source, is…

Q: Categorize the following density-independent factors by their cause and effect. The four categories…

A: The objective of the question is to categorize the given scenarios into four categories based on…

Q: Deep Biosphere Microbes Complete each sentence about the benthic microorganisms. 1. Sediment samples…

A: 1. Sediment samples from water depths up to 8,200 m reveal the presence of a vast *deep…

Q: WHAT IS THE BACKGROUND OF THE TITLE SULFAMETHOXAZOLE: BIODEGRADATION, PLANT UPTAKE, AND IMPACT OF…

A: The title 'Sulfamethoxazole: Biodegradation, Plant Uptake, and Impact of Plant on Microbe' refers to…

Q: If we are assuming 1 x 109 cells/mL for the overnight culture and knowing that a reliable countable…

A: In microbiological practices, especially when performing serial dilutions and plate counts, the…

Immune Disorders

The collaboration between the cells and proteins that work together as a defense system against infection comprises the immune system.Each of them performs a variety of tasks to recognize and/or react against a foreign body.