HOW ALL WORK LDI MOV R11,R16 MOV R16,R28 ASR R16 ADC R16, R11 MOV R29,R16 STD Y+6, R16 SEI R16, HIGH(RAMEND) R11- R28= R16= R29= Y= Provide the final values of the status flags after the final instruction (0, 1, or U for unknown) H V I
Q: Is it possible to analyze simple service systems?
A: Introduction: In recent years, there has been a lot of interest in the study and analysis of service...
Q: As a worst-case scenario, the whole institute might be destroyed if a war takes place. What would yo...
A: Summary: - Hence, we have discussed all the points.
Q: Case Exercises Amy walked into her office cubicle and sat down. The entire episode with the blond ma...
A:
Q: What's the difference between Stored Procedures and Scripts? What is the purpose of each? How does e...
A: The solution to the given problem is below.
Q: QUESTION 11 Which of the following statements regarding R functions is true? O a user-defined functi...
A: Answer: I have given answered in the brief explanation
Q: 10). In is fixed. interrupts the starting address A. External interrupt B. Vectored interrupts C. No...
A: Actually, An interrupt is a signal informing a program that an particular event has occurred. It cau...
Q: How can a security risk assessment assist the organization?
A: Security risk assessment is a type of risk management tool that is used to identify and provide info...
Q: What components are required to build a web-based application?
A: Introduction: Using the HTTP protocol, web-based applications are any software that may be accessed ...
Q: Draw the truth table of the boolean expression X = A.B.C + A'.C' + A'.B'. Do, not simplify the expre...
A: Draw the truth table of the boolean expression X = A.B.C + A'.C' + A'.B'. Do, not simplify the expre...
Q: Che postfix form of A+B*C-D is a. ABCD+/* 5. АВС*+D- c. *AB/CD+ d. A*BC+/D The result evaluating the...
A:
Q: Problem 1 (Stacks): Let S1 and S2 be two stacks. 1. It is possible to keep two stacks in a single ar...
A: The answer is given below:-
Q: What is included in computer printouts when automated methods are used?
A: Introduction: Text or pictures that have been printed out are known as a printout. A physical copy ...
Q: By examining the featur programs if applicable, Excel spreadsheet?
A: Microsoft Excel Spreadsheet The data is displayed in horizontal and vertical rows using Microsoft Ex...
Q: Which of the following are ways that you can make your code easy to read and to navigate? (Check all...
A: Answer: I have given answered in the brief explanation
Q: Question:: Do parallel/distributed databases have a distinct advantage over centralized ones?
A: Ans : True that parallel/distributed databases have a distinct advantages over centralized ones tha...
Q: A processor uses a serial link to communicate with a keyboard for word processing. A typist using th...
A: For 120 words per minute =120 * 6/60 = 12 cps Each character requires 10 bits ( 8 bits for characte...
Q: Implement the Shape hierarchy -- create an abstract class called Shape, which will be the parent cla...
A: Answer :-
Q: What is the definition of NOSQL? What is the relationship between NOSQL and NOSQL database managemen...
A: NoSQL, also referred to as "not just SQL" or "non-SQL," is a database design paradigm that permits t...
Q: What features are typical when using an NVR
A: Defined the features are typical when using an NVR
Q: using python to code the elipse of halleys comet.
A: Lets see the solution in the next steps
Q: Vhat security flaws are exploited and how ma Computer Damage?
A: Any decrease in data integrity or acquisition is defined as data damage.There are three types of dam...
Q: An organization has purchased a class B address 150.5.0.0 and would like to create a network of 100 ...
A: Summary: - Hence, we have discussed all the points.
Q: Write a Python program to show the use of the isinstance() function to check whether the value 0.5 i...
A: Required:- Write a python program to show the use of the isinstance() function to check whether the ...
Q: Most business users will have access to self-service BI tools in the next years, but Gartner expects...
A: - We need to talk about the current behaviour of working of the companies and the importance of mobi...
Q: What type of possible error messages you can get when you try to login with the ssh- option?
A: The Answer is
Q: When did the first desktop computer appear?
A: Here is your answer.
Q: 10). In is fixed. interrupts the starting address A. External interrupt B. Vectored interrupts C. No...
A: Vectored Interrupt is those with a fixed vector address (starting address) and after doing so, syste...
Q: A record company wishes to use a computer database to help with its operations regarding its perform...
A: EER is a high information term that combines all of the ER model's extensions. Enhanced ERDs are ele...
Q: Write a program to enter the value of three variables in TextBoxes. Find and print (the maximum and ...
A: #include <stdio.h> int main(void) {int a=1,b=2,c=3;int max=(a>=b&&a>=c)?a:(b>...
Q: 10). In is fixed. interrupts the starting address
A: According to the question vectored interrupts helps makes starting the service to assign for the dis...
Q: Question 1f: Convert the following hexadecimal number to decimal: ACEF 44271
A: Note: This is a multiple-question-based problem. As per company guidelines, only the first question ...
Q: B. Write a program that prompts for students' final grades in a given class (the grades are integer ...
A: In the code, five variables and one array is declared by the name no(number of students...
Q: 5. What are some of the worries that people have about 5G cellular network technology?
A: Note: As per bartleby answering guidelines, we can answer a single question from multiple posted. Po...
Q: Question:: What's the difference between Stored Procedures and Scripts? WVhat is the purpose of each...
A:
Q: (a) Which Gradient Descent algorithm (stochastic, batch, of small batch) will achievé thể Bêst solut...
A: Gradient Descent: In machine learning and neural networks gradient descent is the one of the most po...
Q: Question No 2 There are many programming languages for specific software solution, then justify give...
A: a) That's because when you join an open-source project or obtain a job, it's not you who decides wha...
Q: Question:: What's the difference between Stored Procedures and Scripts? WWhat is the purpose of each...
A: Answer: I have given answered in the brief explanation
Q: A={L,M,N,P,Q} and B={L,R,S,P,T} , Find the output of A-B ?
A: Discrete mathematics is part of computer science which consists of sets, functions, relati...
Q: Do parallel/distributed databases have a distinct advantage over centralized ones?
A:
Q: Q6. Provide a shell-script that renames all files in the current directory. You will need to add the...
A:
Q: How can I locate the Wifi security for the following security type: When the standard technique fail...
A: WIFI Protected Access II is a security protocol used to protect wireless computer networks. It impro...
Q: Write a program to generate the numbers following: a) (-1, 3, -5, 7, -9, 13, -15, 17, -19, 23) on Te...
A: A program to generate the following numbers (-1, 3, -5, 7, -9, 13, -15, 17, -19, 23)
Q: 2-Determine the output of the following functions (You must show your works) c. (cdaaddaar '(((oran...
A: 2-Determine the output of the following functions (You must show your works) c. (cdaaddaar '(((orang...
Q: B. Write a program that prompts for students' final grades in a given class (the grades are integer ...
A: Code: import java.util.*;public class Main{ public static void main(String[] args) { //scanner c...
Q: Find the terms a3 through a8 of the sequence defined by the recurrence relationship a = 2?n-1 + ?n-...
A: The relationship is mentioned below for the recurrence relation:
Q: In Symbian, Android, and iPhone, what impact has the file deletion algorithm had?
A: Introduction: Deletion algorithms are a set of rules and instructions, or a formula, for erasing dat...
Q: Question:: What's the difference between Stored Procedures and Scripts? WVhat is the purpose of each...
A: A stored procedure is a collection of Structured Query Language (SQL) statements with a common name ...
Q: What's the difference between Stored Procedures and Scripts? What is the purpose of each? How does e...
A: Introduction: A stored procedure (also known as a proc, storp, sproc, StoPro, StoredProc, StoreProc,...
Q: 10). In is fixed. interrupts the starting address A. External interrupt B. Vectored interrupts C. No...
A: Vectored Interrupts: These are those interrupts which have fixed vector address (starting address o...
Q: Consider the following -- $OB0000 org dc.1 MyVal $123456 The 68000 instructions in the following tab...
A: No some are bytes/words & only change the last chunk of the register
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images
- Someone has modified the utils.asm file to insert a PrintTab subprogram immediatelyafter the PrintNewLine subprogram as shown below (changes are highlighted in yellow).The programmer complains that the PrintTab command cannot be called using the "jalPrintTab" instruction. What is wrong, and how can this be fixed? Explain all theproblems in the code this programmer has written.# subprogram: PrintNewLine# author: Charles Kann# purpose: to output a new line to the user console# input: None# output: None# side effects: A new line character is printed to the# user's console.textPrintNewLine: li $v0, 4 la $a0, __PNL_newline syscall jr $raSomeone has modified the utils.asm file to insert a PrintTab subprogram immediatelyafter the PrintNewLine subprogram as shown below (changes are highlighted in yellow).The programmer complains that the PrintTab command cannot be called using the "jalPrintTab" instruction. What is wrong, and how can this be fixed? Explain all theproblems in the code this programmer has written.# subprogram: PrintNewLine# author: Charles Kann# purpose: to output a new line to the user console# input: None# output: None# side effects: A new line character is printed to the# user's console.textPrintNewLine: li $v0, 4 la $a0, __PNL_newline syscall jr $ra .data __PNL_newline: .asciiz "\n"PrintTab: li $v0, 4 la $a0, tab syscall jr $ra.data tab: .asciiz "\t"Through this programming assignment, the students will learn to do the following: Practice processing command line arguments. Perform basic file I/O. Use structs, pointers, and strings. Use dynamic memory. This assignment asks you to sort the letters in an input file and print the sorted letters to an output file (or standard output) which will be the solution. Your program, called codesolve, will take the following command line arguments: % codesolve [-o output_file_name] input_file_name Read the letters in from the input file and convert them to upper case if they are not already in uppercase. If the output_file_name is given with the -o option, the program will output the sorted letters to the given output file; otherwise, the output shall be to standard output. In addition to parsing and processing the command line arguments, your program needs to do the following: You need to construct a doubly linked list as you read from input. Each node in the list will link to the one in…
- The ".text" section of an ELF file contains the machine code of the compiled program. Question 1 options: True False Both the ".symtab" and the ".debug" sections will be loaded into the memory when the loader loads this ELF file into the memory for execution. Question 2 options: True False For a function of "int f(){static int x = 0; return x;}", the compiler (say, gcc) will allocate space for this static variable in the ".data" section. Question 3 options: True FalseC Programming: Write a separate program that takes one command line argument indicating a binary stack file (e.g., stack.bin). Provide an appropriate error message in case of a missing filename or error opening it. The sample output is shown below that it must print out. Show the full code with the sample output being run in the terminal. There must be no errors at all. Sample Output: function: 0x5639db7fc2ca, caller: 0x7f8b8f372290, frame pointer: 0x7ffd23831070stack frame: 0x7ffd23831080-0x7ffd23831070, time: 0.003484 (2158-5642)address range initial final0x7ffd2383107f-0x7ffd2383107c: 00007f8b | 00007f8b0x7ffd2383107b-0x7ffd23831078: 8f372290 | 8f3722900x7ffd23831077-0x7ffd23831074: 00000000 | 000000000x7ffd23831073-0x7ffd23831070: 00000001 | 00000001 function: 0x5639db7fc1d9, caller: 0x5639db7fc2f3, frame pointer: 0x7ffd23831050stack frame: 0x7ffd23831060-0x7ffd23831030, time: 0.002587 (2173-4760)address range initial…Computer Science I get an error in my code: Exception thrown at 0x00000001 in Project4.exe: 0xC0000005: Access violation executing location 0x00000001. I'm confident that the Irvine32 libraries are properly implemented and I'm using MASM x86 Assembly language in C++ Please fix the code! INCLUDE Irvine32.inc .data msg_system_params db "System Parameters on Stack", 0 msg_separator db "___________________________________________", 0 msg_format db "Address: %08Xh => Content: %08Xh", 0 newline db 0Ah, 0 .code main PROC ; Set up stack frame push ebp mov ebp, esp ; Push variables onto the stack push 1 push 2 push 3 push 4 push 5 ; Call runLevelOne procedure call runLevelOne ; Clean up the stack mov esp, ebp ; Restore stack frame and return pop ebp mov eax, 0 ret main ENDP runLevelOne PROC ; Set up stack frame push ebp mov ebp, esp ; Display text "System Parameters on Stack" lea eax, msg_system_params call displayText ; Display separator line lea eax, msg_separator call displayText ;…
- Hi, in C programming , I try to implement 2 functions to check those followings instructions in a file text : The first function :Find the number of words with duplicates on a file The second function: • Find the most frequent letter (without considering duplicates) Finally write those results on another file. ThanksPlease write a c++ program that will take in a file, a number_of_bytes and number_of_threads. So it will take in 3 arguments in the command line. mmap the number_of_bytes of the given file into memory. The program will mmap 100 Megabyte of file into memory and use 4 threads to examine the bytes. The main will not participate in the computation, but will create the specified number of threads, and wait for them to complete the computation, and the main will then print the answer. At most 8 threads will be specified to be created. Each file will contain a long string of letters like DNA, i.e. a,c,g,t The program should determine how many 20-character substrings contain more than 11 a's. For example, in this string there are characters matches: tattataaagtagaaatataactgaaggttcagccgctggattataaagtagaaatataaaaagtagaaatataactgaa The program should output: total matches number # number is replaced by the correct numberProject 1-UNIX Shell Design a C program that copy the file "input.txt" to "out.txt" using Ubuntu (Linux) system calls. The program will create the directory (~/OS-Project) to store the file "out.txt" inside it. The program will skip m letters at a time. The process of reading will start from the letter of index i. The values of m and i must be provided by the user.
- PLEASE MODIFY THE BELOW CODE BY USING INTERRUPTS. #include <iostream>#include <cstdlib>#include <time.h>#include <chrono>#include <pthread.h> using namespace std::chrono;using namespace std;#define NUM_THREADS 40 struct AddTask{int *v1,*v2,*v3;int start;int end;}; void randomVector(int vector[], int size){for (int i = 0; i < size; i++){ vector[i] = rand() % 100;}} void *AddVector(void* arg){ AddTask *task = (struct AddTask *) arg; for(int i = task->start; i< task->end ; i++){task->v3[i] = task->v2[i] + task->v1[i];}} int main(void){ pthread_t threads[NUM_THREADS]; unsigned long size = 100000000; srand(time(0)); int *v1, *v2, *v3; auto start = high_resolution_clock::now(); v1 = (int *) malloc(size * sizeof(int *));v2 = (int *) malloc(size * sizeof(int *));v3 = (int *) malloc(size * sizeof(int *)); randomVector(v1, size); randomVector(v2, size); for (size_t i = 0; i < NUM_THREADS; i++) {struct AddTask *task = (struct…Computer Science Write a Python function that takes in a socket, and reads in bytes from the socket connection until a newline is encountered. All bytes read so far that are even (0, 2, 4, 6, 8) are then returned. Do not handle exceptions; assume all parameters are validWhich of the following is not a programming convention to avoid a potential pitfall associated with the use of smart pointers? If you use a smart pointer and an exception occurs in your program, remember that you must use the delete operation to manually free the memory associated with the smart pointer. Don't use get() to initialize or reset another smart pointer. If you use a pointer returned by get(), remember that the pointer will become invalid when the last corresponding smart pointer goes away. Don't delete the pointer returned from get). If you use a smart pointer to manage a resource other than memory allocated by new, remember to associate a deleter function when declaring the smart pointer. Don't use the same built-in pointer value to initialize (or reset) more than one smart pointer. O O