Glycosylation is a major type of protein post-translational modification. Identify the amino acid that is joined to each monosaccharide by a glycosidic bond. glycoprotein A glycoprotein B glycoprotein C HA HO Н CH,OH HO ОН H Н Н CH₂OH H ОН Н HO Н -NH-C-CH2C-H HN-C-CH3 0 ОН О OH CH₂OH O=U НН НН Он ОН НО Н Н C=0 NH 1 ________ -O-CH2-C-H А В С
Q: Which statement best describes the protein structure shown below?
A: Proteins are a type of biomolecules that are made up of amino acids. They perform variety of…
Q: 3. You are studying an interaction between an antibody and the antigen shown below. The amine next…
A: All ionizable groups have their characteristic pKa value. pKa is the pH at which half of all the…
Q: how is sfGFP different than the wildtype GFP found in jellyfish
A: The question is asking about the differences between sfGFP (superfolder Green Fluorescent Protein)…
Q: Solution A: 200 mM glucose; solution B: (100 mM NaCl + 50 mM KCl). Which of these two solutionswill…
A: The objective of the question is to determine which of the two given solutions will have the highest…
Q: 2. Frank and Barbara have type B blood. Their first child has type O blood. What is the chance that…
A: The objective of this question is to determine the probability of Frank and Barbara's children…
Q: 1. Calculate the pH of the following solutions a. 2 μM HCI b. 3 x 10-³ M KOH
A: The objective of this question is to calculate the pH of two different solutions: one is a 2 μM HCl…
Q: Riboswitches... permit transcription elongation only when bound to a small-molecule ligand. are…
A: Riboswitches are the mRNA segments that act as regulatory elements. They are involved in the control…
Q: 6. Malate dehydrogenase catalyzes the following reversible reaction: NAD+ NADH + H* IZI malate…
A: Biological oxidation-reduction reactions or redox reactions involve the transfer of electrons from…
Q: Explain in why carbohydrates can be bad for you( give 3 examples)
A: Carbohydrates — fiber, starches, and sugars — are essential food nutrients that your body turns into…
Q: G Protein-Coupled Receptors
A: G Protein-Coupled Receptors (GPCRs) play a critical role in cellular signaling by transducing…
Q: Question 7
A: The question is asking about the capabilities of stem cells, specifically whether they can divide,…
Q: Identify the true statements regarding disulfide bridges (disulfide bonds). Disulfide bridges are…
A: Disulphide bonds or disulphide bridges are the covalent bonds formed between the thiol groups of two…
Q: 32) You are working with an molecule with a pl of 6.00 and the pka's of the ionizable groups on the…
A: ● If the pKa is lower than the pH the molecule will be deprotonated i.e it will carry negative…
Q: Draw an approximate titration curve of glycine. Label the approximate isoelectric point of the…
A: A titration curve is a graphical representation of the pH of a solution as a function of the volume…
Q: The genome of SARS-CoV-2 is a single-stranded sense (coding) mRNA that is translated into many…
A: The three prime untranslated region is abbreviated as 3'UTR. It is the part of messenger RNA that…
Q: The following question focuses on how the parameters regulating enzyme function might change, and…
A: Michaelis-Menten (MM) plot and Lineweaver Burk (LB) plot are drawn to decipher the kinetic…
Q: What is the purpose of adding hydroquinone? What is the purpose of washing the egg homogenate with…
A: Lipids are the important biomolecules which are soluble in fats and insoluble in water. Hence they…
Q: Your friend hasn't been feeling well, and you think that she should get tested because it could be a…
A: PCR or polymerase chain reaction is a lab procedure that amplifies fragments of DNA or RNA by using…
Q: If you discover that a protein binds more than one molecule (ligand). How can you determine whether…
A: Proteins are the large and complex biomolecules composed of a large number of amino acids attached…
Q: Which analogue involves a retroinverso peptide isostere? CH₂ A с CH3 Ö G O NH FX NH S OH OH S B D S…
A: Retro-inverse peptide:1. The sequence of parent chain is reversed such that the N side to C side…
Q: Genetics Question 3
A: The SRD5A2 gene provides instructions for making an enzyme called 5-alpha reductase 2. This enzyme…
Q: 4. Which amino acids do not react to produce a purple color with ninhydrin. Why?
A: Biological macromolecules are the molecules that are needed in a sufficient quantity for the…
Q: Draw the structure of the tri-peptide Leu-Asn-Ser at pH 7.4. Use wedges and dashes around the…
A:
Q: A peptide has the sequence Glu-His-Trp-Ser-Gly-Leu-Arg-Pro-Gly The pK₂ values for the peptide's side…
A: Recall that:Amino acid sequences are written with N-terminal amino acid on the left and C-terminal…
Q: Genetics Question 9
A: The objective of the question is to determine whether the statement that cystic fibrosis can be…
Q: Electrostatic interactions among amino acid residues on proteins may be damped out by high…
A: Amino acids are biomolecules that have a hydrogen atom, an amino group, a carboxyl group and a…
Q: 5. Explain the difference between a centriole and a centromere
A: The objective of this question is to understand the difference between two key components of a cell:…
Q: topic: enzymes In which organs or tissues are they usually present in the human body? Tabulate your…
A: the presence of enzymes in various organs or tissues in the human body along with citations:…
Q: EF-G is a macromolecular mimic of EF-tu. It's role in translation is to To cause the large subunit…
A: Translation is the synthesis of the protein from m RNA. There are various initiation and elongation…
Q: Mutations in adenylate kinase have led to a hyperactive enzyme that ultimately ends up elevating ADP…
A: Given ATP = 0.5 mMADP = 12.2 mMAMP = 80uM
Q: (3) Can the disaccharide in question (2) be used to make a silver mirror? Why?.
A: Disaccharide is a carbohydrate molecule formed by the condensation of two monosaccharide units. The…
Q: A protein has been sequenced after cleavage of disulfide bonds. The protein is known to contain 3…
A: There are four classes of biological macromolecules: Nucleic acids, Proteins, Lipids and…
Q: Which of the following would be present in the urine of dogs that were fed phenylpalmitate? (Note:…
A: Phenylpalmitate is an ester of fatty acids. Hydrolysis is the process by which the esters of the…
Q: GQ 5
A: The objective of this question is to determine the probability of two fruit flies with genotype Ee;…
Q: 7. Complete the scheme for isocitrate dehydrogenase. Name the reactant and product. Draw and name…
A: Kreb cycle or citric acid cycle is a sequence of reactions that take place in mitochondial matrix…
Q: 10. Experimental Determination of AG" for ATP Hydrolysis: A direct measurement of the standard…
A: Since conditions inside the cell are different than standard temperature and pressure, biochemists…
Q: Genetics Question 7
A: The objective of the question is to determine the genetic characteristics of the polydactyl trait in…
Q: Not all the bases of an mRNA message are used for coding. Which of the following is a possible…
A: mRNA is messenger RNA that is translated by the ribosomes and generate a protein product. It has…
Q: A nonapeptide was determined to have the following amino acid composition: (Lys)2, (Gly) 2, (Phe) 2,…
A: Trypsin - Cleaves at Carboxyl terminus of basic amino acid such as lysine and arginine. Ahead of…
Q: Genetics Q1
A: The objective of this question is to calculate the probability of Joe and Cindy's children…
Q: Dihybrid Cross Problem 1: Predicting combinations of alleles in gametes of plants heterozygous for…
A: The objective of this question is to predict the distribution of alleles in the gametes of a pea…
Q: The first recombinant human growth hormone (available in 1985) had an extra amino acid (relative to…
A: Human growth hormone (hGH or HGH), commonly referred to as somatotropin or growth hormone (GH), is a…
Q: Carbohydrates differ in solubility based on the size of the molecule. Which of the following…
A: Carbohydrates are the biomolecules which are classified into monosacharides, oligosaccharides and…
Q: 2.7 Now that you have figured out the reaction mechanism, let's explore the action mechanism of the…
A: Mechanism of the given reaction.Here the 2 chloroethylamine react with two nucleophilic groups of…
Q: Glyceraldehyde-3-phosphate (GAP) is converted to 1,3-bisphosphoglycerate (1,3-BPG) as shown. GAP + P…
A: Gibbs free energy or delta G is obtained by combining the change in the thermodynamic quantities,…
Q: What is the hydrophobic effect and how does that play a role in cell membrane formation?
A: The hydrophobic effect refers to the tendency of nonpolar substances to aggregate in aqueous…
Q: Throughout the semester we have seen that regulation is a key aspect of Biochemistry. It affects all…
A: Biochemical reactions and metabolic pathways are very important to be regulated as it enables the…
Q: Question 2
A: The objective of this question is to determine the genotypes of the parent pea plants based on the…
Q: How can gene duplication aid in phenotypic divergence? Briefly describe how the lac repressor and…
A: Lac operon codes for three genes; Z, Y and A which are essential for lactose metabolism i.e. these…
Q: In mixed inhibition as shown below, please draw a lineweaver-burk plot when Kl is greater than KI'.…
A: Michalis Menten equation for given reactionE + S ESE+PVo - Initial velocity or initial reaction…
Step by step
Solved in 3 steps with 1 images
- Match the post-translational protein modification to its function. Creates new binding sites by neutralizing positive charges Form protein complexes through quatenary structures Protein localization in the endomembrane system Targets proteins for degradation Creates new binding sites by adding negative charges Lipid anchors Glycosylation Alkylation Polymerization Phosphorylation Aceylation Ubiquitination…Which of the choices are types of posttranslational modifications a newly synthesized protein may undergo? Select all the choices that apply. changes to hydrogen bonding capabilities formation of an amide bond between Cys and an isoprenyl group removal of prosthetic groups removal of the thiol group from a Cys residue modulation of charges on amino acids proteolytic cleavage covalent attachment of oligosaccharides to Asn, Thr, or SerAmino sequence: Gln-Glu-Val-Leu-Ile-Arg-Leu-Phe-Lys-Gly-His-Pro-Glu-Thr-Leu-Glu-Lys-Phe-Asp-Lys-Phe-Lys-His-Leu-Lys-Ser-Glu-Asp-Glu-Met-Lys-Ala-Ser-Glu-Asp-Leu-Lys A) List the fragments generated with trypsin: B) List the fragments generated with chymotrypsin (5 pts) (assume reaction conditions are used to maximize cutting to the C-terminal size of only the 3 aromatic amino acids.)
- c=0 OH CH2 H CH2 H CH, H. H-Nt CH' CH N. CH CH CH' H CH CH3 H CH H CH2 CH, CH, CH2 CH2 CH3 CH2 CH2 * NH3Here is a putative peptide sequence (position number on top of residues): 1 2 3 4 5 6 7 8 9 10 11 12 13 NH2- G C G N V T H N Q C V L S -COOH If expressed in a eukaryotic cell (please mark your answer in the blank space): Position(s) ___ could be N-glycosylated Position(s) ___ could be modified with myristic acid and the bond formed would be a ______________ Position(s) ______and _____ could be modified with palmiti c acid and the bond formed would be a ______________ Positio n(s) ________ could be a segment of a lipid-linked protein with a farnesyl anchor and the bond formed would be a ______________ Position(s) ________ could be a segment of an O-glycosylated protein Position(s) ________ could be modified with a glycosylphosphatidylinositol (GPI) anchor Position(s) ________ could be phosphorylatedTranslate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3 O met-ala-phe-lys-stop O met-ala-phe-lys- met-tyr-his-gly-val-stop-met-gly O met-ala-ser-gly-thr-stop O tyr-his gly-val-stop-met-ly O ala-phe-lys stop
- Consider the following two peptides: I. N-Pro-Pro - Glu - Glu - Tyr - His - Cys - Ala - Glu - Gln - Lys - Leu - Ser - Ser - Phe-Leu- Thr - C II. N-Pro-Pro - Lys - Arg - Gly - Tyr - His - Gly - Glu - Asp - Glu - Asp - Glu - Ser - Gly-Phe- Tyr-C Give three reasons why_peptide I is more likely to form an alpha helix in aqueous solution at pH 7.0. Your reasons may include why_peptide Il is less likely to form an alpha helixAmino Acid 3-Letter 1-Letter Second letter Code Code Alanine Cysteine Aspartic acid or aspartate Glutamic acid or glutamate | Phenylalanine Glycine Histidine Ala Cys Asp Glu UCU Phe UGU cys UGC UUUT UAU Tyr UAC D UUC UC Ser UUA UAA Stop UGA Stop UAG Stop UGG Trp G UCA Phe Leu UUG UCG Gly G H. His Ile CUU CCU CAU CGU U His CAC CÚC Leu CUA CGC CGA Isoleucine Lysine Leucine Pro Arg Lys K CAA Gin CAG CCA Leu L. CUG CCG CG Methionine Met M AUU AUC le ACU) ACC AAU1 AAC AGU Asn Asparagine Proline Glutamine Arginine Serine Asn Ser AGC AGA Arg Pro P. Thr AAA Gln Arg Ser AUA ACA AUG Met ACG AAG Lys AGG R GUU) GCU) GAU1 GGU GGC Gly Threonine Valine Tryptophan Tyrosine Thr GUC Val GUA GCC Ala GCA Val V GAA GAG GGA W Trp Тут Glu GUG GCG GGG Y Apply all that you have learned to solve the following: If you have the following DNA sequence: 5-ATGGCIOTOGTATTAAATAG-3 1. What is the sequence of the bases in the complementary DNA strand in a 3' to 5 direction ?( NB" Just type the letter for the bases) 2.…Many enzymes are switched "on" by attachment of a phosphate group at a specific serine somewhere on the protein (phosphorylation). The basic reaction is: E + ATP2 Ep + ADP Po SERINE PHOSPHO SERINC (Note the "squiggles" before the backone amide and carbonyl indicate the polypeptide chain continues on either side of the serine). For phosphorylation to have this effect, there has to be some equilibrium between inactive and active forms conformations of the enzyme: [Eactive] [Einactive] Einactive 2 Eactive; K* The same basic equilibrium must exist for the phosphorylated protein: [Ep,active] [Ep,inactive] EP,inactive 2 Ep,active; Kp = (a) If phosphorylation increases the measured activity of the enzyme, is K* or K larger? Why? (b) Does the phosphorylation site need to be near the site where the enzyme binds its substrate (e.g. the reactant whose chemistry it catalyzes)? Why or why not?
- Translate the following amino acid sequence into one-letter code: Glu-Leu-Val-Ile-Ser-IleSer-Leu-IleVal-Ile-Asn-Gly-Ile-Asn-Leu-Ala-SerValGlu-Gly-Ala-SerA polypeptide is digested with trypsin, and the resulting segments are sequenced: Val-Gly Ala-Ala-Gly-Leu-Trp-Arg Arg-Asp-Pro-Gly-Lue-Met-Val-Leu-Tyr-Ala-Ala-Asp-Glu-Lys And the following fragments are produced by chymotrypsin fragmentation: Ala-Ala-Gly-Leu-Trp Arg-Arg-Asp-Pro-Gly-Leu- Met-Val-Leu-Tyr Ala-Ala-Asp-Glu-Lys-Val-Gly What is the sequence of the whole original polypeptide? (Recall that trypsin cleaves a polypeptide backbone at the C-terminal side of Arg or Lys residues, whereas chymotrypsin cleaves after aromatic amino acid residues).Consider the peptide Asp-Lys-Phe-Glu-Asn-Tyr-Gln-Val-Cys. In a single beaker, you treat this peptide with 2 proteases. One protease cleaves at the N-terminus of aromatic R groups and the other cleaves at the C-terminus of polar, non-ionizable R groups. Following the enzymatic digestion, you want to separate your peptide fragments so that you can identify them. You choose to separate the fragments using an anion exchange column. Beginning at pH=6 you apply your peptide fragments to the column and you gradually decrease the pH of the column stopping the separation when the pH of the column equals 4. Omitting chemical structures, write the amino acid sequence of the peptide fragments that are produced from this digest. Write the order that these fragments will elute from the column (if at all). (Relevant pKa values are: 2.1, 3.8, 4.3, 8.3, 9.6, 10.1, and 10.5)