Q: A. Cholesterol B. Phosphatidylcholine C. Thioester-linked and acyl anchor D. Phosphatidylinositol E.…
A: Fluid mosaic model of plasma membrane was given by Singer and Nicolsan. It explains lipid bilayer…
Q: Mutualism with Ants: There are costs and benefits to a plant that provides housing but no food for…
A: Ants are an important carbon source to the plant and hence if ants donot come to the plant, the…
Q: E. coli strains diploid for the lac region were constructed by introducing a plasmid carrying the…
A: ANSWER;- I- mutation- repressor is unable to bind to the operator region. If there is no other…
Q: Which of the following is an INCORRECT combination of a hormone and its class of hormone? a…
A: Hormones can be categorised into three distinct groups according to their chemical composition The…
Q: Given this DNA strand: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Identify the following: mRNA:…
A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…
Q: 17) The predominant theory for long term memory is the use by neurons in the __________ of…
A: Cholinesterase inhibitors work by altering chemical activity in the brain to improve memory and…
Q: Spermatogenesis and Oogenesis result in the production of 4 equally sized meiotic products. Group of…
A: Spermatogenesis and oogenesis are the type of meiotic divisions. It consists of two division the…
Q: What are the various techniques in Molecular Biology used for the Isolation, purification, and…
A: Introduction Proteins:- A protein is an extremely complex natural substance made up of amino acid…
Q: Choose the right combination of components required to set up a polymerase chain reaction from the…
A: PCR ( Polymerase Chain Reaction) The PCR , as it is commonly known was invented by Kary Mullis ,…
Q: In humans, blood pH is maintained fairly precisely around 7.4, and this is largely accomplished with…
A: The pH of blood is maintained mainly by organs like lungs, kidneys and by the internal buffer action…
Q: Discuss some issues raised involving the biosafety and ecological implications of the field-testing…
A: Genetic modification and biotechnology are two terms that are used interchangeably to describe a…
Q: Which group of echinoderms has a biradial symmetry and tube feet all over its body?
A: Tube feet is one of the small flexible tubular processes which present in most of the echinoderms…
Q: Explain how the disease effects the conduction of information and what class of neurons appears to…
A: Multiple sclerosis has no recognised aetiology. It's classified as an autoimmune illness since the…
Q: Which of the following lipids is NOT found in biological membranes? triacylglycerols…
A: Introduction Lipids are important to our body as they store energy, as well as are required for…
Q: Question 41 The model describes the cell membrane as an assortment of integral proteins suspended…
A: Introduction:- The cell membrane, also known as the plasma membrane, is a thin membrane that…
Q: Gymnosperms have ___________ but no fruits or flowers.
A: Two terms are very common in the plant kingdom - Gymnosperms and Angiosperms. Angiosperms are the…
Q: Using CRISPR/Cas9 to target a gene in the mouse will primarily result in: a. Any of the choices b.…
A: CRISPR/Cas9 is a powerful tool that can be used to target and edit genes. This technology has a wide…
Q: 2. a) Briefly describe the divisions of the Marine Environment.
A: An ecosystem is a natural community of living beings that deals with the external environment and…
Q: Female cones may be called a(n) _____________________ cone in the Coniferophyta
A: ANSWER;- Female cones may be called a(n) megastrobili cone in the Coniferophyta.
Q: A heterozygous individual is crossed with a homozygous recessive individual. a. Draw a Punnett…
A: Punnett square of cross between heterozygous individual and homozygous recessive individual.
Q: The egfr kinase independent transactivation of the ras pathway does require egfr. Explain this…
A: EGFR is a cell surface receptor that binds to certain growth factors and sends signals to the cell's…
Q: Examine closely the dissected 5 different flowers for these characteristics based on: -…
A: Characteristics of the given specimens :-
Q: i) Describe and explain i) the role that flight plays in creating these kinds of viruses, ii) how…
A: Bats are classified into mammals with the order Chiroptera. Bats forelimbs are adapted as a wings…
Q: Question 7. How might one test whether the differences in moth density in the two types of plants…
A: Answer :- When sent consistently in the field, hereditarily controlled plant obstruction is…
Q: 40. Administration of prednisone for long periods causes atrophy of which of the following endocrine…
A: Prednisone is a glucocorticoid medication mostly used to suppress the immune system and decrease…
Q: by Rhizobium species?
A: Answer is P,R and S. Nodulation factors (Nod factors) are chitooligosaccharides produced by…
Q: RE: Which type of membrane protein is required for active transport? Why is this type of protein…
A: One of the major representatives on the molecular level for maintaining homeostasis within the body…
Q: region
A: Amgydala is thought to be the central part of the nervous system which is required for the…
Q: 2. Give the pathology in : 1 sentence each only d. Osteogenesis imperfecta e. Henoch-Schonlein…
A: Pathology is the study of the causes and effects of disease or injury.
Q: 88. A 35-year-old man has a stenotic ejaculatory duct. The normal passage of which of the following…
A: The ejaculatory duct is a part of the Male Reproductive System, that is situated on either side of…
Q: what happens to skeletal muscle if there is no ATP present but plenty of calcium. Be specific…
A: Sliding filament theory is the most widely accepted explanation for muscle contraction. It states…
Q: 1) The nitrogenous bases content of a sample of DNA was found to be 3.2% adenine. Determine the…
A: A nucleic acid is a linear polymer of nucleotides that is a component of the cell's information…
Q: An autosomal trait that is expressed in both males and females but not in the same fashion (for…
A: Autosomal trait that expressed in both male and female in different fashion.
Q: Globular cells are said to be spherical. When slightly flattened, they are disc-shaped. Squamous…
A: Ques : What is the shape of the cartilage cell(1), bone cell(2), and cardiac muscle(3) specimens?…
Q: Sassa, a biology professor, wanted to demonstrate to her students the applicability of a dialyzing…
A: Dialysis is a traditional laboratory technique that uses selective diffusion of molecules across a…
Q: When doing a gram stain in microbiology, one step can be eliminated and still allow distinction…
A: Please follow step 2 for detailed explanation.
Q: Match the letters in the empty boxes to the correct words or structures. A B C D E F G Citric acid…
A: Cellular respiration is a metabolic process in which glucose molecule is used up in the synthesis of…
Q: What are some things to look for in secondary sources to help you identify if they are good sources…
A: biology's primary source literature: original research results are written by those who conducted…
Q: HDL is produced via the exogenous lipoprotein pathway? O True O False
A: HDL are the high-density lipoprotein and also called good cholesterol.
Q: Genetic engineering applied for generating food sources is said to be different from traditional…
A: Introduction:- By modifying the genetic composition of crops, genetic engineering and traditional…
Q: II. ATP ACCOUNTING Provide what is being asked for. Show all relevant calculations and summarize…
A: ATP synthase This enzyme is used in the process of oxidative phosphorylation to generate ATP…
Q: Question 4 In ducks, the allele for black feathers (B) is co-dominant with the allele for white…
A: Alleles Alleles are the two different varieties of same gene for example height is gene and long and…
Q: (a) Name the type of blood vessel labelled (i) C. (ii) D. (b) In which direction does blood in…
A: Lungs are essential parts of the respiratory system. A pair of lungs in humans are formed in such a…
Q: The cell cycle contains a series of events that control the division of cells. It is controlled by…
A: Cell cycle can be defined as as a sequence of events ,in which duplication of the genome of the cell…
Q: Milligram of base required to completely hydrolyze & neutralize 1 g of triglyceride/fat sample O…
A: Saponification is described as an hydration reaction, where ester bonds between fatty acids and…
Q: Question 1 Lipids from an organic sample are extracted separately using acetone (A), hexane (H), and…
A: The KHSO4 test is known as acrolein test and is used for fat or glycerol detection. Hexane extract…
Q: Question 4 "The following describe lipoprotein organization, classification & function, EXCEPT: "…
A: Answer is.. "Lipid content is less than protein thus, the higher the % TAG the less dense the…
Q: Question 1. You may have noticed that in each of the three treatments, a portion (20%) of the field…
A: Here natural pesticides resistance or pesticide limiting agents plays an impactful role to control…
Q: How many Barr bodies are contained within the nucleus of a person with Monosomy X? In the nucleus of…
A: Introduction:- The X chromosome is shared by both males and females. Female somatic cells do not…
Q: Question 46 The monospot test is a rapid latex kit for the screening of [Select] for the presence of…
A: The monospot test looks for 2 antibodies in the blood.
Fill in the table using the Antarctic food web. Some animals may go in more than one column.
Step by step
Solved in 4 steps with 1 images
- Which answer below best describes a TRUE statement of the organisms in the food web shown below? Raccoons Ducks Fish + Minnows Aquatic crustaceans Algae and floating plants Minnows and fish are primary consumers. O Algae and floating plants are decomposers. Raccoons, fish, and ducks are secondary consumers. Aquatic crustaceans are producers.True or false A food web shows the number of organisms are in Energy flow Draw a food web by using the names of these organisms. Also mention who's what? (producer, herbivore, omnivore, carnivore, or decomposer).
- Create a food web using those six organisms given.Use the igure below, which shows the Tood web of an aquatic ecosystem, to anSwer the following questions: Killer whale Crabeater seal Elephant seal Adelie penguin Squid Leopard seal Cod / small animals and protists Algae Use the figure below, which shows the food web of an aquatic ecosystem, to answer the following questions: CMAC 1-In the food web above, there are eight food chains that include krill. In the space provided, identify all of the organisms in the order in which they occur in three of these eight food chains Food chain 1 Food chain 2 Food chain 3 3- Identify the most energy efficient food chain for the killer whale. Food chain 3- Draw am energy pyramid for the most energy efficient food chain for the killer whale . 4 2 I 3.Food webs are helpful diagrams to understand the relationships of organisms within a biological community. Answer the following questions using the food web below. Baleen whale Smaller toothed Sperm whale whales Penguins Elephant seal Leopard seal Other birds Fish Other seals Squid Krill Other herbivorous zooplankton Carnivorous zooplankton Phytoplankton Which of the following can be a secondary consumer? squid other seals krill herbivorous zooplankton fish other birds elephant seal
- Below is a diagram of a complex food web. Match the removal of an individual species with the result in the food web. Mackerel Tuna Krill Seal Herring Seals are hunted to local extinction in this community Phytoplankton populations crash because an herbicide leaked into the water The dogfish population is decimated by a disease Dogfish Plankton [Choose ] [Choose ] Cod [Choose ] Scallop > >Food webs are helpful diagrams to understand the relationships of organisms within a biological community. Answer the following questions using the food web below. Baleen whale Smaller toothed Sperm whale whales Penguins Elephant seal Leopard seal Other birds Fish Other seals Squid Krill Other herbivorous zooplankton Carnivorous zooplankton Phytoplankton The phytoplankton transforms light energy into 100,000 kcal (by photosynthesis of course). How much energy would you expect to be available in the elephant seal's food if the elephant seal eats the squid, which eats krill, which eats phytoplankton? O 100 kcal 100,000 kcal 10,000 kcal 10 kcal 1,000 kcalBased on the text on roaches eating: 1. Identify abiotic factors that support the survival and reproduction of roaches and explain why they need this factors 2. Identify biotic factors that support the survival and reproduction of the roaches and explain why they need this factors 3. Predict what factors in the environment can be altered to decrease the survival and reproduction of roaches and why? PLEASE ANSWER ALL QUESTION BASED ON THE TEXT
- Summarize The idea web below summarizes the lesson. Complete the web. Roles of Organisms Carmivores are consumers that makes food for itself and other animals. Bacteria are S The number of predators tends to rise that break down dead matter and wastes. when there is a rise in the number of 484SEAWEED ORCA SQUID MACKEREL HUMAN TUNA RED ALGAE PHYTOPLANKTON MILYFISH Using the food web to the left, complete the following: Name two primary producers: What are the two apex predators? In the space provided, create a food chain that contains 4 organisms:Draw a food web.