Figure 1. A representation of remdesivir and the viral replication machinery for SARS-CoV-2. 6. Figure 1 shows that remdesivir "mimics" an important component of RNA replication. Which component o Adenosine RNA replication has a structure similar to that of remdesivir? . Propose a hypothesis about how remdesivir might inhibit the virus's replication process.

Figure 1. A representation of remdesivir and the viral replication machinery for SARS-CoV-2. 6. Figure 1 shows that remdesivir "mimics" an important component of RNA replication. Which component o Adenosine RNA replication has a structure similar to that of remdesivir? . Propose a hypothesis about how remdesivir might inhibit the virus's replication process.

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter16: Gene Expression

Section: Chapter Questions

Problem 38CTQ: A scientist discovers a virus encoding a Protein X that degrades a subunit of the elF4F complex....

See similar textbooks

Similar questions

Predict the replication step for the novel Miovirus. This virus was determined to have a dsRNA genome Draw out your prediction. Include any proteins/enzymes the virus will need to use, bring or express to carry out the replication. Indicate where it is likely for replication to occur in the host cell.
Within the long-terminal repeat in the retrovirus genome is a PBS. If the PBS was mutated such that the molecule could no longer bind, what consequence would this have on the retrovirus life-cycle? Explain your answer. TTTT Paragraph Arial v a (12pt) E- E. T OIX8
Alternative splicing Template strand S F yIGUide1,mq00:c-00: Replisome Transforming principle Origin of replication (or)eleb al msxS ain Coding strand Transcription factors Leading strand Single nucleotide polymorphism Okazaki fragment Telomerase M Nucleoside RNA Polymerase I RNA Polymerase II RNA Polymerase IIIon & of qu 9ven UoY Insertion mutagenesis Spliceosome Transcription Unit SNP Reverse transcriptase 1 Seminal work by Oswald Avery and colleagues demonstrated that DNA is what Frederick Griffiths called this etniog OS dotsM bioW 1-2kb of newly synthesized DNA strands are called this ainiog PS Assembly of the replisome is an orderly process that begins at these precise sites Snoiteeu 4 Transcribes ribosomal RNA genes in eukaryotes 5. A large nucleoprotein complex that coordinates activity at the replication fork Single base pair differences between homologous genomic regions isolated from different members of a population Complex of proteins and snRNAs catalyzing the removal of…
40 Shown below is the antisense strand of DNA. What is the amino acid sequence that corresponds to this code? 5' AAAGCATACCGG 3' Second letter G. UUU Phe UCU UAU) Tyr UGC Cys UGU UUC UCC UAC Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUA UCA UUG Leu UG CAU His CGU CGC CGA CGG CU CUU CUC CUA CUG CAC Pro Leu Arg CCA CAA) Gin CCG CAG AAU AUU AUC lle AUA AUG Met ACG ACU AGU AAC Asn AGC Ser ACC ACA Thr AAA1 AGA AAG Lys AGG Arg GAU) Asp GGC GAC Ala GAA GGU GUU GUC GUA Val GCU GCC Gly GCA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a PRO-VAL-SER-PHE PHE-ARG-MET-ALA GLY-HIS THR-LYS d LYS-ALA-TYR-ARG First letter Third letter
Replication of many RNA viruses depends on RNA polymerase. The antiviral drug ribavirin does not inhibit the polymerase but instead increases its error rate. Explain how this affects the virus.
87) For a the viral proteins a. If the viral protein is made in the RER, it will go back to the nucleus b. IF they have nuclear localization sequence they will go to the nucleus c. The nuclear localization sequence can be either simple or bipartite of conserved leucine d. If the viral protein is made by free ribosome, most likely it will go to the surface of the ot the cell.
48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of mutation is this? UUU U UUC UUA UCU Phe UCC UAU UGU Cys ANTISENSE 5' GGACCCTAT3' UAC Tyr UGC UAA Stop UGA Stop UAG Stop UGG Trp Ser UCA Leu UUGL" UCG CUU CU CAU) His CAC) CGU CGC CGA Arg CUC C Leu Pro CAA1 Gin CAG) CUA CCA CUG CG CGG AAU AAC Asn AGC AAA AAG Lys AGG Arg AUU ACU AGU Ser AUC lle ACC Thr AUA ACA AGA AUG Met ACG GCU GCC GUU GAU] GGU GUC Val GAC Asp GGC Ala Gly GUA GCA GAA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a FRAMESHIFT SILENT NONSENSE MISSENSE Third letter First letter
EcoRI --- 5' G - AATTC 3' 5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3' 3' TCTTAAGGCTGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5' Number of pieces of DNA , and type of fragment .
In not more than 200 words, explain how eukaryotic RNA synthesized by RNA polymerase II is modified before leaving the nucleus
1. "One structural form used in building virus particles is based on the icosahedron. Describe, either in words or in a diagram, the organization (number of capsomers, etc.) of the simplest virus particle of this form. 2. If a virus has a negative‐sense RNA genome, what enzymatic activity (if any) will be found as part of the virion, and what will be the first step in expression of the viral genome?"
You are working in a research lab studying human Peptide Z, which is a short protein that plays a key role in responding to SARS-CoV-2 virus infection. Your advisor gives you the double-stranded DNA sequence encoding Peptide Z (below), but she neglects to tell you which are the coding and non-coding strands of this DNA before leaving on a six-month sabbatical. 5'-AGA CCC ATG CCT CAG CAG TTC TTT GGA TTA ATG TAA-3' 3'-TCT GGG TẠC GGA GTC GTC AAG AAA CCT AAT TẠC ATT-5' Using your understand of transcription, translation, and the codon table below, determine if the top strand or bottom strand is the template strand of the Peptide Z gene. (Enter either top strand or bottom strand.) What is the sequence of the RNA that encodes Peptide Z? Note that the entire DNA sequence is transcribed. 5' - - 3' What is the amino acid sequence of Peptide Z? Make sure you indicate the carboxyl-terminus and amino-terminus with C and N, respectively.
OF rasc PDF Teas fill Which of the following is NOT a step in the replication of a retrovirus? A diagram illustrating the process is provided below. PDF UNOFFIC TRANSCR 59°F Mostly cloudy Virus Viral RNA Reverse transcriptase DDDDDD ↓Viral DNA Provirus mRNA mm Proteins mn Viral RNA Protease Plasma membrane Host DNA New virus O The single-stranded DNA forms a double-stranded DNA called a provirus, which is incorporated into the host cell DNA. O After a retrovirus attaches to the host cell, it injects its viral DNA and uses the host cell's machinery and materials to replicate. O After a retrovirus injects its viral RNA into a host cell, it forms a DNA strand by reverse transcription. O When the host cell replicates, a provirus produces the viral RNA needed to produce more virus particles. P O Search hun recc PDF maste omiss