Answered: Explain why prokaryotic ribosomes can…

Name: Explain why prokaryotic ribosomes can translate a circular mRNA molecu
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Explain why prokaryotic ribosomes can translate a circular mRNA molecule, whereas eukaryotic ribosomes normally cannot, even in the presence of the required cofactors.

Science

Biochemistry

Explain why prokaryotic ribosomes can translate a circular mRNA molecule, whereas eukaryotic ribosomes normally cannot, even in the presence of the required cofactors.

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter9: From Dna To Protein

Section: Chapter Questions

Problem 15SA: Put the following processes in order of their occurrence during expression of a eukaryotic gene: a....

See similar textbooks

Similar questions

In eukaryotic cells, secreted proteins are initially directed to the endoplasmic reticulum and then via the Golgi, where they are released into the extracellular environment through secretory vesicles. A more easier way would be for secretory protein-producing ribosomes to be localised to a translocon in the plasma membrane, with the protein being secreted directly during translation. Consider three possible benefits of the more roundabout method for protein secretion versus the simpler, more straightforward approach indicated.
Describe the prokaryotic translation initiation shown in the diagram. Define the convention of protein synthesis (directionality of synthesis) as well as the meaning of the A, P, and E sites of the ribosome.
EF-G is a macromolecular mimic of EF-tu. It's role in translation is to To cause the large subunit of the ribosome to disassociate with the small subunit of the ribosome Bind to the vacant A-site subsequent to peptide bond formation and resolve the hybrid state of the ribosome To recruit the signal recognition particle (SRP) to the ribosome and to facilitate synthesis of membrane proteins O To cause the large subunit to associate with the small subunit of the ribosome Shuttle an amino-acylated tRNA to the A site to initiate the peptidyl transfer reaction
Explain briefly how translation is initiated from a) prokaryotic mRNA and b) eukaryotic mRNA. Include names of any relevant sequences on the mRNA, proteins involved, including ribosomal subunits.
List two essential roles of ribosome during translation.
Explain the function of spliceosomes in eukaryotic cells. The following sequence represents pre-mRNA derived from a gene coding for alpha keratin in birds. Label the sequence to show potential exon(s), intron(s) and spliceosome cut site(s). That is, put the intron(s) sequences in parentheses and use black slash symbols (/) to indicate the spliceosome cut site(s). What is the sequence of the mature MRNA after splicing? [ 5' AUGGGUUUAGGACCCCCGAUAAA 3'
In the: Inhibition of splicing by ribozymes Explain: (a) What is the process affected? (b) What is the Effect on the process? (c) Does it affect prokaryotes, eukaryotes or both?
Why chaperones are particularly important when translation occurs on membrane-bound ribosomes ?
For each amino acid incorporated into a polypeptide the cell has to invest three high-energy phosphates (ATP or GTP). At which step of the overall process is energy investment NOT required? What is the correct answer from below? Ester bond formation between a tRNA and an amino acid Release of an aminoacyl-tRNA into the A-site of a ribosome Translocation of a ribosome along an mRNA molecule Peptide bond formation between amino acids none of the above
A gene normally contains an N' terminal ER signal sequence and an internal stop transfer sequence. The ER signal sequence is recognized and used during the protein trafficking process, as normal. After translation is completed a signal peptidase enzyme cleaves the N' ER signal sequence but the internal sequence is not cleaved. Which of the following figures best represents the orientation of the protein product after translation? N Extracellular Extracellular Extracellular Extracellular N Lumen Lumen Lumen Lumen N' D A C O A D
Please describe the four-step process of the elongation during protein translation in bacteria.
Each type of molecule listed below is recognized by a specific class of nuclear import receptor (importin) or nuclear export receptor (exportin). For each type of molecule, state whether you think it is recognized by an importin or exportin and explain why (in terms of where that molecule is synthesized, what that molecule does, and where it does it). (a) RNA polyermase II: (b) ribosomal protein: (iii) †RNA: