Exercise 1 The order of a molecule of mRNA is given like following. b. AAAUGUCAAACGAGGCCGAUCAUUAAACU a- Determine the corresponding non-transcribed strand of DNA based on the above RNA molecule. C b- Name the phenomenon shown in the figures. c- What is the codon of start ? d- Arrange the stages given in the chronological order.

Exercise 1 The order of a molecule of mRNA is given like following. b. AAAUGUCAAACGAGGCCGAUCAUUAAACU a- Determine the corresponding non-transcribed strand of DNA based on the above RNA molecule. C b- Name the phenomenon shown in the figures. c- What is the codon of start ? d- Arrange the stages given in the chronological order.

Name: Exercise 1The order of a molecule of mRNA is given like following.AAA
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Exercise 1The order of a molecule of mRNA is given like following.AAAUGUCAAACGAGGCCGAUCAUUAAACUa- Determine the corresponding non-transcribed strand ofDNA based on the above RNA molecule.Cb- Name the phenomenon shown in the figures.c- What is the co

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter15: Genes And Proteins

Section: Chapter Questions

Problem 24CTQ: A fragment of bacterial DNA reads: 3’ -TACCTATAATCTCAATTGATAGAAGCACTCTAC- 5’ Assuming that this...

See similar textbooks

Similar questions

Instructions: Express your own gene! (1) Make up a DNA sequence of at least 18nucleotides and then (2) show the mRNA sequence that will be made via transcription,(3) show the tRNAs that will base pair and deliver the amino acids, and (4) the aminoacid sequence of the resulting protein. You can use the single letter abbreviations forDNA and RNA nucleotides and the three-letter abbreviations for the amino acids.
Learning Task 3: TRACE THE CODE dentify the amino acids coded for by the MRNA codon using the Genetic Code Table below. Order of bases in mRNA (codon) AUC Order or bases Order of bases Amino acid Coded in DNA in tRNA into Proteins TAG CAT GC СА UAC Methionine Valine Procedures: Copy and fill in the table Refer to the Genetic Code table to identify the amino acid. To determine the order of bases in the first column (DNA), second column 1. 2. 3. (codon) and third column (anticodon), consider the complementary base pairs in DNA adenine pairs with thymine and guanine pairs with cytosine. 4 Example, AUG using the Genetic Code Table. Look for the first letter of the MRNA codon on the left side of the genetic code table (A). The second letter of the MRNA on the second letter column (U) and the third letter on the right-side column (G). AUG codes for the amino acid methionine. To identify the amino acid. Look at the bases in the MRNA codon. 5. Do the same with the other codons in the chart.…
You continue to study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGIAATATĞGGGATGCACTATC 5' 3' AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCA'NTATAÇCCCTACGTGATAG CACTATC promoter RNA polymerase ribosome
Template strand: 5' AATCATAACTCATTG 3' A. Write the CODING strand of this sequence, including the 5' and 3' end designations. B. Write the amino acid sequence coded by this mRNA. The start codon is the first codon in the sequence that codes for Met. First position (5'-end) U < G บบบ UUC phe UUA UUG CUU Couleu CUC Coc CUA CUG AUU AUG AUC ile GUU GUC GUA GUG Second position C UCU UCC UCA UCG val CCU co CCC CCA 000 CCG ACU ACC ACC AUA ACA thr AUA ACA AUG met ACG GCU GCC ser GCA GCG pro ala UAU ORD tyr UAC UAA Stop UAG Stop CAU CAC CAA CAG - AAU AAC www AAA 10 asn AAG 7 his GAU GAC GAA GAG gin }| lys asp glu UGU UGC cys UGA Stop UGG trp CGU C00 CGC CGA 000 CGG AGU AGC ACA AGA AGG GGU GGC GGA GGG Initiation Termination arg ser arg gly DUAL SUAU DUAU DUAG Third position (3-end)
DNA: 5’-CTCTACTATAAACTCAATAGGTCC-3’ Draw a box around the sequence where RNA polymerase will bind to the DNA. What is this sequence called? Will transcription start at this sequence, to the left of this sequence (“upstream”) or, to the right of this sequence (“downstream”)? Draw a small arrow above the DNA strand where transcription will begin. Which DNA strand will RNA polymerase transcribe? Highlight this strand with your highlighter. (Hint: RNA pol is similar to DNA pol because it can only make new RNA in the 5’ to 3’ direction. Draw in an arrow to show the direction that RNA polymerase will move along the DNA strand.
RNA Transcription, Translation, and Mutation Worksheet First, here is a strand of DNA. This strand contains both a gene and its promoter region. Circle the promoter region in blue, draw a yellow box around the TATA box, draw a green box around the start codon, and draw a red box around the stop codon: TATATATATTACGTTGCATACGCTCAACGGTCGAAACTGCATGGGCAC ATATATATAATGCAACGTATGCGAGTTGCCAGCTTTGACGTACCCG Now imagine this gene has been transcribed into RNA. What would that RNA strand look like? Before the above RNA strand can be translated, a few modifications must first take place (in eukaryotes). What are they? 1) 2) 3) Using a codon chart of your choice (one can be found here, or here) translate the above RNA transcript (assume no splicing took place). Write the three letter abbreviations for the amino acids in the image below: Now imagine that a mutation took place in the original strand of DNA (marked in red) TATATATATTACGTTGCATACCCTCAACGGTCGAAACTGCATG…
Original sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3
Remember when looking up a codon make sure it is in its mRNA form. Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 2.What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this? Often this type of mutation does show symptoms until middle age. What problem does this create? 3.What are three differences between a point mutation and deletion mutation
Learning activity 5 1) A segment of DNA has the following sequence of bases ...5'-ATGCAATGATATTGAAGCTTA -3'... a.) what sequence of bases would appear in MRNA transcribed from this segment b.) assume that the first base in this MRNA is the beginning of a codon. What order of amino acids would be translated into a polypeptide synthesized along this segment? c.) give anticodons for each tRNA associated with the translation in part (b)
1Need help:. draw valine-aminoacyl tRNA synthetase. Show the tRNAs and the valine amino acid. You can use the one-letter code for valine (V) and do not have to draw the amino acid structure. Label the tRNA and amino acid binding sites on the enzyme. Explain the function of valine-aminoacyl tRNA synthetase and explain why there are 20 related enzymes in every cell.
Exercise In this exercise we will practice transcribing and translating sample DNA. Using your sample DNA, unzipped and second strand removed, you will first create an RNA strand (transcription). DNA is read in the 5' → 3' direction, so when you create RNA, a 3'end pairs with the 5' end of DNA. From your RNA strand, you will need to create codons; remember that a codon is a group of 3 bases that codes for a specific amino acid. Your codons are read in the 5' → 3' direction (hint: it might be right to left!). You will then need to convert your codons into amino acids in the 5' → 3' direction (translation). DNA strand 3' TAC-TTA-CGA-TGG-TAC-ACG-CAA-TCT-ATA-CTC-AAA-TAT-AGG-ACC-TTG-ACG-TCG-AAT-CTC-CAC-TGT-ACC-TTG-AAC-CTG-ACT 5' RNA strand 5'-AUG-AAU Amino acid sequence G ne (9)
INSTRUCTION: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS FALSE = IF FIRST STATEMENT IS FALSE WHILE SECOND STATEMENT IS TRUE = IF BOTH STATEMENTS ARE FALSE STAMENT 1: Amino acyl tRNA synthase is the enzyme responsible for joining amino acid together STAMENT 2: Nucleus is the part of the cell where translation takes place ANSWER: STAMENT 1: DNA sequences where RNA polymerase binds initially is called promoter sequences STAMENT 2: UV light causes adenine to dimerize ANSWER: STAMENT 1: Guanosine is the name of the compound formed when guanine is bonded to ribose STAMENT 2: DNA pairing is the term that refers to the process when two complementary and single stranded DNA combine ANSWER: