Directions: Transcribe the following strand into mRNA, then translate it into amino acids Example DNA TACAAAAACAAGGTAACGGTCATC mRNA AUGUUUUUGUUCCAUUGCCAGUAG AA Start-Phe-Leu- Phe-His-Cys-Gln-Stop DNA TAC-CTA-CTC-ATA-GAT-CTG-CTT-ATC mRNA AA :: GAU :: UAU :: UAG :: Methionine (Start) :: GAG :: Leucine :: Stop :: Tyrosine :: AUG :: GAA :: Glutamic Acid :: CUA :: GAC :: Serine :: Glycine :: Aspartic Acid
Q: A recombinant protein corresponding to 52 repeats of the peptide sequence YSPTSPS was covalently…
A: The peptide sequence YSPTSPS is a known phosphorylation site that corresponds to the heptad repeat…
Q: Which one of the following statements best describes the mechanism by which the "cell cycle control…
A: The question is about the cell cycle control framework, a pivotal biological process that guarantees…
Q: Match the common name of the animal with its most correct taxon by pulling down to the correct…
A: Coordinating the common names of a few animals—specifically, a toad, a caecilian, and a…
Q: Using the plasmid map attached and the answer from the previous question, draw a simplified diagram…
A: The image you provided shows a diagram of the YCplac33 plasmid. This plasmid is a commonly used…
Q: What is the difference of intragenic and intergenic regions? Please explain with drawing.
A: In the intricate tapestry of the genome, the terms "intragenic" and "intergenic" encapsulate…
Q: Based on the information shown (picture) draw the pedigree for this family in the space provided…
A: The task at hand involves constructing a pedigree chart for a family, based on a detailed family…
Q: To what class does this animal belong?
A: Reptilia encompasses a mix of reptiles—snakes, lizards, turtles, and crocodiles. Triceratops, the…
Q: How many ancestry tests did the twins take? A. 2 B. 3 C. 4 D. 5
A: The question is asking for the number of ancestry tests taken by the twins. However, the question…
Q: what are the alleles
A: An allele is one of two or more possible forms of a gene that can be found at the same location on a…
Q: cells, causing the development of a plant tumor which provides an
A: Promoter Regions and Regulatory Sequences: In the DNA sequence of the Ti plasmid, genes likely to be…
Q: (Theme 5) Below are data from Jimenez et al (2022) depicting cellular expression patterns of the…
A: The question pertains to the intriguing phenomenon of cellular expression patterns, specifically…
Q: A new beneficial mutation arises in a population of bacteria (haploid microbe) with a population…
A: Mutation refers to a change in the nucleotide sequence of the DNA contained in the genome of an…
Q: You have found that two types of bacteria (one large, one small) can undergo horizontal gene…
A: Bacteria are small single cell organisms. They found everywhere on earth. Some of them can survive…
Q: Explain one of the mechanisms discussed in class by which a person’s genetics may be correlated with…
A: Every person has a specific microbiome in his gut. It completely depends upon the type of food and…
Q: Is it true that as the sperm travels toward the secondary oocyte, the enzyme cap gets thicker so…
A: Fertilization is the process of union of two germ cells, egg and sperm, by which a new individual…
Q: Which of the following is the specific gene that is most often used for DNA Barcoding of animals?…
A: Animal DNA barcoding is a biological method that allows species identification and differentiation…
Q: QUESTION 2: What are the names of the steps of the PCR reaction that are repeated multiple times…
A: Polymerase Chain Reaction, or PCR, is a molecular biology technique employed to amplify and…
Q: In your own words, explain the following concepts and provide at least one example for each:…
A: Non-concordance in biology refers to the lack of agreement or consistency between two or more sets…
Q: The center solid curve represents the oxygen dissociation of hemoglobin, pH, Oxyhaemoglobin (%…
A: It has been asked about the Bohr impact, a physiological phenomenon that portrays how hemoglobin's…
Q: (Theme 5) AraC is a transcriptional activator that binds to the AraC binding site and is encoded by…
A: The introduction of arabinose into the bacterial culture serves as a trigger for the activation of…
Q: 3. Identify the 2 components of the Eukaryotic cell resulting from primary endosymbiosis and name…
A: Endosymbiosis as a Concept:The term endosymbiosis refers to a symbiotic relationship between two…
Q: Please list the mixyure of cell types that form tissues such as skin and describe the function of…
A: Tissues are collections of cells that work together to carry out particular bodily functions.…
Q: Q6.8. Imagine that after the birds have been living in the city for many years a second big flock of…
A: Carrying capacity:The environment contains limited resources and hence can only sustain a limited…
Q: 3. Draw the three metaphases as indicated for a cell that is 2n=4 genotype Aa Ee. Gene A is on the…
A: IntroductionMeiosis is a type of cell division that produces gametes (sperm and egg cells) with half…
Q: What two things distinguish us (and other hominins) from other primates? A. Bipedalism and…
A: Hominins refer to a group of species that belong to the human lineage after the split from the…
Q: An animal lives in an environment with lots of predators and few areas in which to hide. This animal…
A: The question is centered around the concept of life history strategies in evolutionary biology. Life…
Q: 1. Which type of cell division (mitosis or meiosis) results in: Cells Haploid cells Diploid cells…
A: Mitosis is type of cell division in which DNA of cell nucleus is split into two equal sets of…
Q: The hypothesis for the experiment shown in the picture  is that the TamC3 and TamR3 cell lines…
A: The experiment referring to is, exploring the function and growth of TamC3 and TamR3 cell lines in…
Q: What happened to large animals in the areas where our species migrated? A. We domesticated…
A: The question is asking about the impact of human migration on large animal populations in the areas…
Q: BLO JUXTAGLOMELLULAR APPARATUS Label the following: Juxtaglomerular apparatus* Granular (JG) cells*…
A: One of the kidney's main structures, the juxtaglomerular apparatus (JGA), is essential for…
Q: Read the following family history and draw a pedigree to determine the inheritance pattern for…
A: Achondroplasia is genetic disorder in which a person has short limb dwarfism. In this disorder the…
Q: Isthenia gravis, you have to understand the chain of events from the conscious decision to move a…
A: Sensory organs consists of sensory neurons that convey the information to the central nervous system…
Q: mRNA is synthesized in the direction. direction, which corresponds in The____ of the protein A,…
A: mRNA transcription is the process of copying a segment of DNA into a complementary RNA molecule…
Q: Cleavage and polyadenylation are tightly coupled. What key factor involved in both processes ensures…
A: RNA cleavage and polyadenylation are essential processes in eukaryotic gene expression, particularly…
Q: A substance has a mass of 2.50 pounds (1 pound = 453.59g) and volume of 2.25L (1L-1000 ml). What is…
A: Density is a physical property of matter that describes how much mass is contained in a given…
Q: A bacterial culture is grown using either octadecane (C18H38) or pentachlorophenol (C6HOCl5)) as the…
A: Bacteria can utilize various carbon sources for growth and energy production. The efficiency of…
Q: Using the data listed above, construct a gene map between the genes R,S, and F. Calculate map unit…
A: A gene map illustrates the relative positions of genes on a chromosome and the distances between…
Q: 1) Describe the change of Cis-aconitate to Isocitrate.
A: Since you have asked multiple questions, we will answer the first question for you. If you want any…
Q: One of the main acidic components of acid rain is sulfuric acid, H₂SO4. Assuming sulfuric acid is…
A: Given:Concentration of H2SO4 in acid rain (C_H2SO4) = 1.310 × 10^-4 MVolume of acid rain sample…
Q: What are the different hypotheses that might explain the stature of Homo floresiensis? A.…
A: The question is asking about the different hypotheses that might explain the small stature of Homo…
Q: The operation of the sodium-potassium "pump" moves (sodium or potassium) Blank 1. Fill in the…
A: Ion transport in cells mainly occurs through two ways active transport and passive transport.Active…
Q: Compare and contrast cilia and flagella
A: A small cellular structure called an organelle serves particular activities within a cell.…
Q: If you were to send in your DNA to a genetic ancestry company, who is your DNA compared to? A.…
A: The objective of the question is to understand who your DNA is compared to when you send it to a…
Q: Complete the following table outlining the products consumed and released by the following…
A: Autotrophs are organisms that can produce their own food from the substances available in their…
Q: Discuss the Lymphatic structures in the animal body
A: An fundamental portion of the circulatory framework in vertebrates, the lymphatic system…
Q: Match the specific dinosaur character/feature to its most correct dinosau by pulling down to the…
A: Anterior facing/pointing pubis bone: This characteristic is associated with dinosaurs of the…
Q: What are some potential solutions to decrease the threat/endangerment of sea turtles? What can…
A: Sea turtles are marine reptiles that are known for their long lifespan. They are an important part…
Q: Liquid condensates may be a useful physico-chemical property of the overall transcription reaction.…
A: Liquid condensates or biomolecular condensates are dynamic, micron-scale compartments in eukaryotic…
Q: 1. What increased proportionately more with moderate exercise, TV or breathing rate (frequency of…
A: Identify the change in tidal volume (TV) and breathing rate.Tidal volume (TV) increased from 500 mL…
Q: Your essay should be prepared and cited using MLA format. Submit your final work as a single…
A: Instruction• Part 1: Using your understanding of DNA technology and evolution, summarize changes…
Transcribe the following strand in Mrna, then translate it into amino acids
Step by step
Solved in 3 steps
- DNAT A C C G C T C C G C C G T C G A C A A T A C C A C T mRNA ______ ______ ______ ______ ______ ______ ______ ______ ______ AA ______ ______ ______ ______ ______ ______ ______ ______ ______Complete the complementary strand: mRNA transcription ATTCGAGGCTAATranscribe the following DNA sequence into RNA, and then into amino acids 5’-GTATACTTGTGGGCCAGGGCATTAGCCACACCAGCCACCACTTTCGGATCGGCAGCC-3’ 3’-CATATGAACACCCGGTCCCGTAATCGGTGTGGTCGGTGGTGAAAGCCTAGCCGTCGG-5’
- This molecule: -is involved in translation -may bind to the “start” codon on mRNA -has an amino acid attachment site at one end -has an anticodon at the other end ______GENE A DNA ACCGGTTAT MRNA Amino AcidmRNA Codon Chart: Second letter с บบบ UCU UAU Phe UUC UCC U Ser UAC Tyr UGU UGC Cys UUA UCA Leu UAA Stop UGA Stop A UUG UCG UAG Stop UGG Trp CUU CCU CAU CGU CUC CCC His CAC Leu Pro CUA CCA CAA CGA Arg Gin CUG CCG CAG CGG AUU ACU AAU AUC lle ACC AAC AGU ]Asn Ser AGC A Thr AUA ACA AAA Lys AGA Arg AUG Met ACG AGG GUU GCU GAU GUC GCC Val GAC Asp GGU GGC Ala GUA GCA GUG GCG GAG GGG GAA Glu GGA Gly Amino Acid 3-Letter Codes Name of Amino Name of Amino 3-Letter Code 3-Letter Code Acid Acid Alanine Ala Leucine Leu Arginine Arg Lysine Lys Asparagine sex Methionine Met (start) Aspartic Acid Asp Phenylalanine ebe Cysteine Cve Proline Pro Glutamic Acid Glu Serine Ser Glutamine Gln Threonine Glycine GLK Tryptophan JAR Histidine His Tyrosine Tyr Isoleucine lle Valine Val Exercise: Transcription & Translation 1. Choose 3 DNA Templates. 2. Write the mRNA sequence divided into 3 letter codons. 3. Write the sequence of amino acids. 4. Find the corresponding amino acid sequence and include the letter of…
- WATCH REVIEW VIDEO: How to Read a Codon Chart DO NOT START UNTIL YOU FIND AN AUG IN THE MRNA AND STOP WHEN YOU REACH A STOP CODON (codon chart is on next page, sorry) DNA mRNA Amino Acids ATC-TAC-AGC-TTC-CCG-TGA-ACT Ala Asp Glu UC UCAG UC AG Ser UCAG Tyr5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. Write the resulting amino acid sequence using the 3 letter code. Write the answer in a all capital letters. Leave a space between the amino acids. Do not write 5' and 3'.Sequence 1 : TACGCTACGGTAATC Sequence 2: TACGCTACTATCGTA