Q: What is the difference among the true ribs, false ribs, and floating ribs? (Why are they labeled…
A: Introduction :- The bony skeleton, or rib cage, of the chest is made up of many pairs of narrow,…
Q: A 0.1ml aliquot of a bacteriophage stock with a concentration of 4* 10- phage/ml is added to 0.5ml…
A: The multiplication of infection (MOI) can be calculated as the number of phage per bacterium.
Q: EXPLAIN HOW MITOCHONDRIA PARTICIPATED IN CELL DEATH??
A: Apoptosis is interceded by proteolytic enzymes called caspases, which trigger cell death by cleaving…
Q: Calculate the percent oxygen saturation of myoglobin if 7 of 15 binding sites are occupied..
A: Myoglobin displays a regular curve - as you increase the concentration of oxygen, myoglobin becomes…
Q: During neuronal signaling, a change in membrane potential will cause sodium channels to open and let…
A: The sodium potassium pump, also known as the Na+/K+ pump or Na+/K+ ATPase, is a protein pump found…
Q: Relative to carrying capacity, what from unbridled continued growth population? o foto may result of…
A: Population Growth refers to the increase or decrease in the size of a population over time,…
Q: One of the characteristics of botulinum toxin (the cause of 'botulism') is a very specific protease…
A: Neurotransmitters A chemical that secreted by the ends of nerve fiber into the synaptic cleft.
Q: What are the three cons of deciduousness?
A: The word deciduous in biology describes a tree, shrub, or other plant which totally loses its…
Q: 1. Two molecules that can pass easily through the plasma membrane, between phospholipids, include…
A: Plasma membrane The membrane which is selectively permeable and allow only certain molecules to pass…
Q: Referring to the degeneracy of the genetic code, explain why alterations to the first base of a…
A: We know there are four nitrogenous bases in a DNA or RNA like adenine(A), Thymine(T) in case of…
Q: which of the following changes in the plasma membrane of a salmon is most likely to occur as it…
A: Cell membrane is made up of phospholipids and proteins. These are arranged as fluid mosaic model as…
Q: Describe the types of mutation discussed in class and the consequences these havefor the evolution…
A: A mutation is a permanent change in the DNA of a cell such that the sequence deviates from what is…
Q: What is the primary use of the antiviral drug acyclovir? Using terms already covered in class,…
A: What is primary use of the antiviral drug Acyclovir? Describe its mechanism of action.
Q: Which of the following statements correctly describes why white muscle fibers do not need is mini…
A: In vertebrates, the muscle system helps with the movements and posture of the body. There are mainly…
Q: Discuss the components of a motor unit. What is the difference between a motor unit and a motor…
A:
Q: Could the mini-prep protocol purify RNA? Why or Why not? Based in your answer, what is the…
A: RNA Miniprep protocol is the RNA isolation protocol which is available and designed for easy,…
Q: What is/are true statements about Action Potentials? Select all that apply. Group of answer…
A: Action potential is a rapid rise and fall in voltage or membrane potential across cell membrane.…
Q: Gluconeogenesis cannot use as a substrate. O Pyruvate O Alanine O Glutamate Palmitate
A: Glucose is an important carbohydrate molecule that is central to energy consumption. This glucose is…
Q: 8 10 Biosphere 2 was a failed experiment at creating an enclosed self-sustaining ecosystem. The…
A: Green house A artificial house created by humans to grow plant irrespective of there season.
Q: why must we take the human population Size into account when we attempt to develop environmental…
A: We must consider the human population size when we attempt to develop environmental restoration…
Q: A population consists of 300 individuals with the following genotypes: AA – 100…
A: Since p = 1 - q and q is known, it is possible to calculate p as well. Knowing p and q, it is a…
Q: Based on the Movement of Water across a Selectively Permeable Membrane lab, what is a selectively…
A: Introduction :- An very thin layer of protein and fat makes up the cell membrane. It is referred to…
Q: The following describes the concentration of particles in a heavily salted solution: O a Hypertonic…
A: Osmolarity is a process of measurement of solute concentration. It is the number of osmoles (Osm) of…
Q: What type of vertebra articulates to the top of the sacrum? Identify the set of tiny bones that…
A: The sacrum is a large bone located at the terminal part of the vertebral canal, where it forms the…
Q: D In the following DNA strand, find the position of the start codon, stop codon and determine the…
A: The given DNA strand - GGTACTTTATACCCTGATACATTTGTGGGG Corresponding mRNA strand -…
Q: The input region lacks _________________, but contains _____________________, Group of answer…
A: Introduction A ligand is a material that combines with a biomolecule to generate a complex for…
Q: Describe pinocytosis, phagocytosis and receptor mediated endocytosis.
A: Describe pinocytosis, phagocytosis and receptor mediated endocytosis.…
Q: Human (and fly) males are said to be hemizygous for a(n) ________ trait. Responses recessive…
A: Introduction Sex-linked traits are associated with genes that are found on the sex chromosomes. In…
Q: Why is it important to perform both quality control and assurance in a cytogenetic laboratory? Does…
A: Cytogenetics is the study of chromosome alterations, such as damaged, absent, altered, or…
Q: ) Explain homology, list and explain the different types of homologies (also give examples)and why…
A: In some species there are similar features or structurs between them which indicates they shared a…
Q: A population consists of 300 individuals with the following genotypes: AA – 100…
A: . The Hardy-Weinberg principle states that allele and genotype frequencies in a population will…
Q: b) It's said that secondary structures form because of intra- and intermolecular hydrogen bonding…
A: Proteins are one of the major 4 biomolecules, these act as building blocks of biological tissues.…
Q: Of the family of viruses we've studied, what type of virus is HIV (human immunodeficiency virus)?…
A: A virus is an infectious microbe made up of a nucleic acid segment (either DNA or RNA) surrounded by…
Q: treatment 1 has steady growth treatment 2 has stead growth treatment 3 has steady growth…
A: Positive control Positive control is the treatment that affect the growth of subject.
Q: Follicle-stimulating hormone stimulates the production of a. steroids in the adrenal cortex. b.…
A: Hormone Also known as chemical messenger of the body. They are secreted from the different gland…
Q: Hydrophillic is the following: O a. Water Loving or Water Attracting O b. Water Repelling O c. Polar…
A: Introduction :- An object that is attracted to water molecules and has a propensity to dissolve in…
Q: In transcription, the termination signal is a DNA sequence that tells RNA polymerase to A stop…
A: DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) are nucleic acids and serve as carriers of…
Q: In measuring photosynthesis in crop species, you find that two species respond differently to a…
A: Introduction Plants and other living things employ a process called photosynthesis to transform…
Q: How can transposons contribute to specific human diseases?.
A: Introduction Genetics is a branch of science that deals with the study of genes, heredity, and…
Q: Please describe the detailed procedures of southern blot. Explain the protocol and principle of…
A: By separating DNA, RNA, or protein molecules according to their size and electrical charge,…
Q: 6. Some bacteria produce chemicals that provide food with a certain taste. Name two such foods.
A: Hydrochloric acid (HCl) destroys the maximum amount of bacteria in a healthy stomach. Bacteria can…
Q: Student Y is working with his microbiology experiment, the directions of the agar is to suspend 25g…
A: In microbiology experiment, we generally use 15-20ml media for each petri dish. Here we can consider…
Q: A female who is heterozygous for tongue rolling reproduces with a male who is homozygous recessive…
A: Genotype can be define as the combination of charecteristics which can be observed by our naked…
Q: 20. Which of the following rows identifies the reproductive hormone levels that coincide with severe…
A: The chemical compounds or substances secreted by cells of various glands of the endocrine system are…
Q: there is a cellular sack that is impermeable to starch molecules and is filled with a solution,…
A: Tinicity is the term we use when a solution have ability to move water in and out of the cell with…
Q: D In fava bean plant the seed color can be coded by two alleles, green (G) which is dominant and…
A: True breeding plants are those that have homozygous alleles (which means two copies of a single…
Q: Cyanide binds with metals. Based on this information, what process in aerobic cellular respiration…
A: Cellular Respiration is a process by which the cells produce energy from food in the presence of…
Q: Allosteric enzymes in biosynthetic pathways are often inhibited by the binding of a ligand. The…
A: All biological systems are well regulated. There are various regulatory things in our body, that…
Q: In the lake the biomass of plankton decreased from 65000 to 50000 kg. As a result the biomass of the…
A: In the food chain, one organism eats another. The first trophic level is of producers which include…
Q: Each spinal nerve branches into a ventral and dorsal: ganglion root tract plexus ramus
A: Introduction According to the classical doctrine of the nervous system, an animal's nervous system…
Compare and contrast cut & paste and replicative transposition.
Step by step
Solved in 2 steps
- Draw the gel electrophoretic pattern that would be seen in dideoxy sequenceanalysis of the DNA moleculeHi, I would like to know which program is used for the graphical presentation of the results of a meta-analysis of genome-wide linkage scans?Describe the technique of in situ hybridization. Explain how it can be used to map genes.
- Explain the importance of how Polymerase Chain Reaction, Gel Electrophoresis and Restrictions Enzymes can be used in the real world.Please briefly explain what gel electrophoresis is and how it works to separate a mixed sample of macromolecules like DNA.Using the 5 major steps, make or create your own flow diagram of the genetic engineering process (isolation, cutting, ligation, transformation, colony screening)