Cite 3 scientists who made great contributions in the discovery/study of photosynthesis. Explain their discoveries in relation to photosynthesis
Q: Explain the signaling steps that take place after the EGF receptor is dimerized, up to the poiunt…
A: As per our company guideline we are supposed to answer only first question or only first 3 subparts…
Q: give examples of 4 different values of hematocrit and explain their meaning
A: Hematocrit is a measure of the percentage of red blood cells in the body. if a person has 50…
Q: What are some general similarities in how receptive fields are represented by the nervous system?…
A: Receptive field is a region in the sensory periphery within which stimuli can influence the…
Q: Members of some species will sound warning calls when they notice predators even though this…
A: In this statement, the individual making alarm noise is not being provided a survival advantage…
Q: Give economic and ecological significance of Corn (Zea)
A: Zea It is commonly known as corn. It is a cereal grain. The plant has a leafy stalk which have…
Q: Two homologous chromosomes in ES cells are depicted below with the portion of your gene of interest…
A: CRISPR/Cas9 creates specific double-stranded breaks at the target locus that trigger DNA repair…
Q: (a). What is the role of calcium ions and troponin during contraction in striated muscles of hum
A: Introduction - Myofibrils, which contain a specialised protein (myoglobin) and chemicals to deliver…
Q: happens when traits become more common in a population because of the reproductive success of…
A: Mechanical isolation is defined as the physical incompatibility between the reproductive organs of…
Q: Ant species work together to collect food and build the mounds they live within. This behavior…
A: Ants are distributed in all different habitats and everywhere on the planet but less in Antarctica,…
Q: 2) Now you would like to raise antibodies to this protein of YFG. How could you use the pure protein…
A: Antibodies generate by the immune system in body against the antigen which is foreign particle…
Q: What is the main reason for archiving your phage? so that you could repeat the DNA isolation (for…
A: The answer is to store your phage long term so that anyone who accesses the phage database could…
Q: All about RNA editing A. changing one or more nucleotides in the RNA transcript by deamination B.…
A: In this question when we look at options then we don't need to check B and C options as it's in…
Q: What would happen to a person whose body did not produce bile ?
A: Bile is the fluid which is synthesized and secreted by liver and stored in the gallbladder. Main…
Q: what part of the brain is involved with intelligence?
A: The direct answer to the question is the cerebello-parietal component & the frontal part. These…
Q: A Moving to another question will save this response. Question 9 Which of the following statements…
A: When considering workout for weight loss or muscle gain, it's a better idea to be consistent and…
Q: which of these is characteristic of gram positive, gram negative bacteria or mycobacteria have a…
A: Bacteria are microscopic prokaryotic ubiquitous organism which do not have nucleus nor membrane…
Q: 1 Why is the bulk milk hauler an important link in assuring high-quality milk for humans? What…
A: Bull milk contain high amount of calcium and minerals. These are necessary for bone develpoment.…
Q: What is the pH of blood? The pH Scale Ammonia Stomach Acid Vinegar Coffee Water Baking Soda Solution…
A: pH is the measure of how acidic or basic a liquid is. Range of pH scale is 0-14. <7 being the…
Q: Assignment in Modules 4-6 Matching Type: Match Column A with Column B. Type the answer before the…
A: 1) phenylketonuria is the genetic defect in which the child is unble to breakdown the protein called…
Q: My field is COSMETIC SCIENCE What information can be obtained from UV-vis Spectra and how this can…
A: Ultraviolet Visible spectroscopy (UV-Vis spectroscopy) is an analytical technique, which measures…
Q: QUESTION 25 What is the value of identifying prevalent base changes found in different cancer types?…
A: Cancer is a fatal disease that has both physical and mental consequences for a person. Cancer can…
Q: The form of oxygen found toxic to microorganisms is rendered non-toxic by a. Superoxidase which…
A: Superoxide is composed of highly reactive oxygen atoms. It has the ability to reduce metal ions and…
Q: Which theory of aging states that unstable oxygen molecules tend to steal electrons as they bounce…
A: The unstable oxygen molecules have higher energy and can damage the biomolecules.
Q: A heart microslide demonstrates cells in the shape of pale chords, which have few myofibrilla,…
A: 2. ANSWER;- Contractile cells, Purkinje's fibers Explain;- Contractile cells conduct impulses and…
Q: David isolated 3 unidentified strains of bacteria from a patient's wound. He wants to determine if…
A: Lysogeny is the state where a host cell contains one or more prophages and lysogenic cells contains…
Q: What is the significance of Juxtaglomerular apparatus in kidney function.
A: Introduction - The kidneys are two bean-shaped organs located on either side of your spine, below…
Q: A classical experiment studying the fate determination of stem cells in the developing embryo uses…
A: Neural crest cells give rise to melanocytes, smooth muscles cranial cartilage, facial cartilage and…
Q: how the genes are related to intellectual disability in details
A: Answer :- As we know that incorporates Fragile X disorder (FXS), the most well-known acquired type…
Q: For one ribosome-specific antibiotic, identify the specific step in translation that it blocks?
A: Drugs that are used to treat microbial infections are commonly referred to as antimicrobial agents.…
Q: Which of the following is not true regarding DOGEMs sequencing? it could result in more than one…
A: Answer :- Option (A) is correct. - It could result in more than one complete phage genome sequence.
Q: design a bacterial/archaeal species, what would be its characteristics (e.g. shape, arrangement,…
A: Bacteria are small unicellular microorganism that lacks any proper cell organization (which means no…
Q: Please help Why did we use nanoparticles?
A: Nanoparticles are the techniques which are used in the biotechnology which used to identify the gene…
Q: If an antisense RNA is designed to silence the following mRNA sequence, which of the following…
A: mRNA sequence:-5' UAGGACUAUUAAGGUACACCCAUU 3' to silence this sequence the antisense RNA should be…
Q: During a heart attack, oxygenated blood flowing to the heart muscle is interrupted by blockage of a…
A: HEART ATTACK Heart attack is a condition in which the flow of oxygenated blood to the heart is…
Q: 13 15 DSS karyotic organisms that cause infections eases that can't be caught (passed from person to…
A: Disease is a state of illness which could be contagious that is spread from person to person or…
Q: Continuing from the question above. You are able to correctly modify the blood stem cells and return…
A: Sickle cell anemia is majorly due to missense mutation which results in valine substitution in place…
Q: Which types of macromolecules (protein, carbohydrate, fat, or nucleic acid?) can be enzymatically…
A: Digestion is accomplished by mechanical and chemical processes. Enzymes aid in chemical digestion.…
Q: BLASTP helps to predict the function of phage proteins by finding the e-value of phage proteins O…
A: BLAST stands for Basic Local Alignment Search Tool (BLAST) This is helpful in finding location of…
Q: What are nutritional disorders
A: Introduction :- Any nutrient-related disease or condition that causes illness in humans is referred…
Q: Most have well defined 3' ends terminating in poly(A) tails of - 200 nt. A prokaryotic mRNAs B…
A: The 3' ends of RNA transcripts synthesised by RNA polymerase II are produced bynthe endolytic…
Q: n prokaryotes, the sigma factor recognizes base sequences in the which facilitates RNA polymerase…
A: Sigma factors play a key role in the regulation of gene expression in response to changing…
Q: retort pouch is: a) Filled first with food product and then retorted (heat-sterilization) to extend…
A: In retort pouch food is filled into a pouch . Then it sealed and next heated to extremely high…
Q: You take a sample of cancerous tissue from Individual II-6 from the prior question. What will the…
A: X- linked inheritance X linked inheritance is a pattern of inheritance when the trait is controlled…
Q: Describe the features of the fluid mosaic model of the cell membrane.
A: Cell membrane It is defined as the membrane that protects the cell from its environment by…
Q: Compare and contrast the adaptive structures of the insect ectoparasites and the endoparasites.…
A: Ectoparasites are organisms that live just on skin of humans and other animals and are classified as…
Q: A scientist hypothesizes that dysregulated insulin signaling is responsible for the development of…
A: Metabolic syndrome A cluster of conditions that increase the risk of heart disease, stroke and…
Q: Which of the following is a correct representation of a segment of DNA? 1. 5'ATTC3' 4. 'ATAG3'…
A: A DNA segment has two strands - coding strand and non coding strand. Coding strand is represented in…
Q: STUDY QUESTIONS 1. List down at least 3 differences in the anatomy of male and female frogs. 2. How…
A: Frogs are amphibians and humans are mammals.
Q: Explain the neutral theory of molecular evolution (20%) and how you use it as a null hypothesis to…
A: There are multiple evolutionary terms that helps in establishing a role in the molecular evolution.…
Q: Why is oxygen needed for cellular respiration to occur (what is its role at the mitochondrial…
A: Cellular respiration is the metabolic process that takes place in the mitochondria of cells. It…
Trending now
This is a popular solution!
Step by step
Solved in 4 steps
- I need a clear and concise definition of photosynthesis.Photosynthesis is divided into light reactions and dark reactions. Define the purpose of each of these as well as the overall inputs and outputs for each stage. Edit View Insert Format Tools Table 12pt v Paragraph |BIU Av S OTE A O FEB étv MacBook Air F11 80 F8 F9 F10 F6 F7 F4 F5 2 F3 * へ 23 $ 6. 8. 4 R T Y U EWhat is photosynthesis? Be unique on the answer. 1paragraph
- What is the function of C4 plants and CAM plants in photosynthesis? Make the explanation as short (not super short like it's straight forward) this is for our reporting, i'm assign on the function. SUBJECT : CAM AND C4 PHOTOSYNTHESIS 1. Definition 2. Difference 3. Function (this is my part) 4. Inputs and outputs 5. Duration and occurrences Thank you and stay safe!!Explain in detail the role and importance of photosynthesis to life on this planet. Include what the inputs and outputs of the process are.genuity.com/Player/ Test Active TIME F 11 12 13 14 15 16 17 18 19 20 01: hich statement best describes the relationship between photosynthesis and cellular respiration? O Photosynthesis removes carbon from the atmosphere, and cellular respiration releases carbon back into th atmosphere. O Photosynthesis is part of the carbon cycle, and cellular respiration is not. O Only plants perform photosynthesis, and only animals perform cellular respiration. O Photosynthesis releases carbon into the atmosphere, and cellular respiration removes carbon from the atmosphere. Save and Exit Next Submit Mark this and return Entor Shitt
- A. Explain the role of ATP in life process. B. Complete the following table by comparing and contrasting the light-dependent and light-independent reactions of photosynthesis. You may use the link below for reference. https://youtu.be/KfvYQgT2M-k Light- independent reactions Point of Light-dependent reactions Comparison 1. Raw materials 2. Part of the chloroplasts where they occur 3. Light requirements 4. Products 15. Ву-productsPlease describe the carrier molecules in photosynthesis (where, when, why) Thanks very much for your helpam.edgenuity.com/Player/ Unit Test Active 11 12 13 14 15 16 17 20 TIME REMAINING 01:46:28 Which statement best describes the relationship between photosynthesis and cellular respiration? O Photosynthesis removes carbon from the atmosphere, and cellular respiration releases carbon back into the atmosphere. O Photosynthesis is part of the carbon cycle, and cellular respiration is not. O Only plants perform photosynthesis, and only animals perform cellular respiration. O Photosynthesis releases carbon into the atmosphere, and cellular respiration removes carbon from the atmosphere. Mark this and return Save and Exit Next Submit
- Profiles Tab Window e College N Netflix 930/mod_resource/content/4/Photosynthesis Discussion QuestionsF2020.pdf 2020.docx 31 000 000 FA % 5 MAR 26 X Help F5 Microsoft Word - Photosynthes X 2/4 | — 100% + 6 4. What purpose does the light reaction play in carrying out the overall purpose of photosynthesis? 5. What purpose does the Calvin Cycle play in carrying out the overall purpose of photosynthesis? 6. Light reactions: a. Describe the path of an electron from water until it ends up in NADPH. You can draw a picture if it helps. F6 b. Describe how the process of ATP production is similar and different to ATP production in cellular respiration. 7. Calvin Cycle: a. Following the carbons: cut out the following slips of paper and order them as they occur in the Calvin Cycle. Next, using the atoms sets, build 3 RuBP ♫ 9/ A 9 MacBook Air & 7 EX F7 tv B * x | + 8 DII F8 ( 9 DD F9 ) 0 W F10 f 6009 Sun Mar 26 12:02 F11 ☐ + Vtopic: photosynthesisO2 produced during photosynthesis comes from water. Comment.