Briefly outline how MLPA probe-sets can simultaneously detect multiple targets using a single set of PCR primers.
Q: What is the functional difference between regular PCR and qPCCR?
A: PCR stands for a polymerase chain reaction. As the name suggests that polymerase chain reaction…
Q: How real time RT-PCR can be used in detecting SARS-nCov2 virus? Please explain at your own words.
A: Reverse transcription- Polymerase chain reaction (RT-PCR) is a technique in which the RNA is…
Q: How does an RT-PCR work?
A: RT- PCR is a technique used in genetic studies used for the detection and quantification of mRNA.…
Q: What do you need to pay attention to when designing SNP specific primers for the detection of gene…
A: When we designing SNP specific primers for the detection of gene sequences pay attention on…
Q: RT-PCR can determine the amount of mRNA for a particular gene in two different growth conditions.
A: Reverse transcriptase polymerase chain reaction (RT-PCR) is a laboratory technique combining…
Q: Describe the methods of site-directed mutagenesis and CRISPR-Cas technology.
A: A molecular process in which some discontinuous change to nucleotide sequences in their genomic DNA…
Q: What phase of PCR (exponential, linear, or stationary) is analyzedto quantitate the amount of DNA or…
A: The genetic entity of the organism is mainly composed of nucleic acids. The nucleic acids DNA and…
Q: Describe a method of labeling a DNA probe. Explain how this probe maybe detected after DNA…
A: The probe is basically a single stranded sequence of DNA or RNA which is used commonly for the…
Q: What is the difference between the first steps of DNA sequencing to PCR in terms of the number of…
A: PCR or polymerase chain reaction is used to amplify the DNA sequence. Since DNA polymerase amplifies…
Q: What are DNA probes
A: When two single-stranded DNA or single-stranded RNA molecules are allowed to be together and form…
Q: What type of probe is used for real-time PCR? Explain howthe level of fluorescence correlates with…
A: In the conventional amplification technique of PCR (polymerase chain reaction), the amplified…
Q: What is vector? Discuss 2 vectors that are commonly used in DNA recombinant technology.
A: Answer- Vector- vector is a DNA molecule that is used to carry a foreign DNA into the host cell. It…
Q: cite one reason why the RT-PCR test for COVID-19 detection may give a false negative result. assume…
A: RT PCR is reverse transcptase polymerase chain reaction used to determine the presence of virus in…
Q: Explain the Detection of simple sequence repeat (SSR) polymorphisms by electrophoresis of PCR…
A: Polymerase Chain Reaction is a technique to generate the copies or to amplify the DNA region…
Q: Explain about quantitative real-time PCR (qPCR) ?
A: PCR is a method used to form millions to billions of copies of a particular sample of DNA. It allows…
Q: Briefly explain how synthetic probes are created to screen a DNA library when the protein encoded by…
A: Synthetic probe is fragment of DNA. to screen a DNA library RNA of variable length approximately 100…
Q: Compare and contrast ex vivo and in vivo gene therapy as approaches for delivering therapeutic…
A: Viral vectors are used as carriers for normal genes that replace the defective genes within the…
Q: Briefly describe two different methods for inserting foreign DNA into plasmids, giving the strengths…
A: The plasmid is typically a small circular deoxyribonucleic acid (DNA) strand in the cytoplasm of the…
Q: Outline the steps by which the polymerase chainreaction (PCR) amplifies a specific region of a…
A: Polymerase chain reaction or PCR technique is used to amplify or make multiple copies of a specific…
Q: Discuss the process and principle involved for screening/selection of hosts (last stage of cloning)…
A: Molecular cloning or cloning is a technique to assemble DNA of two different organisms and directing…
Q: How the efficiency of PCR amplification can be calculated?
A: PCR proficiency can be characterized as the ratio of the quantity of target gene molecules toward…
Q: What is the addition and limitation of the RT-PCR approach? Keep CoViD-19 in mind
A: Viruses are a nucleoprotein entity which is able to utilize the synthetic machinery of a living cell…
Q: Discuss the importance of components of PCR reaction in detail
A: Polymerase chain reaction (PCR) is a laboratory technique, which is used to make multiple copies of…
Q: What are the different types of PCR and their product concepts? Site and explain the comparison…
A: Introduction :- Polymerase Chain Reaction (PCR) is a molecular biology technique for making multiple…
Q: Explain two parameters that should be considered when designing primers for PCR.
A: PCR stands for Polymerase Chain Reaction. Using this technique, a fragment of DNA can be amplified.…
Q: What type of enzymes are used to “cut” desired DNA sequences for use in recombinant gene technology…
A: Note: As Per Guidelines, We Can Answer One Question At A Time. Ask Again To get rest answers.…
Q: Why is it necessary to examine gene-expression profiles, in additionto genome sequences, for…
A: Gene expression profiling is the analysis of the behaviour of thousands of genes at once to…
Q: Microarray hybridization is used mostly in transcript profiling or assaying DNA variation. Although…
A: A usual microarray technology includes the hybridization of an mRNA with its original template of…
Q: Explain how the percentage efficiency of a real-time PCR reaction S determined using a theoretical…
A: Real time PCR is intended to gather information as the response is continuing, which is more exact…
Q: CGATTGCAGGTTATAGCG. Which of the following primer pair can be used to amplify this template with…
A: Polymerase chain reaction can be used to make large quantity of DNA from a small DNA sample. In this…
Q: Why do you think the DNA is stored cold with the InstaGene matrix after boiling the samples and…
A: The polymerase chain reaction (PCR) is used to replicate a specific portion of DNA millions of…
Q: blue-white colony selection method in the recombinant colony screening
A: Blue - white screening for selection recombinat colony :- Blue - white screening is a rapid and…
Q: Consider the following human genetic diseases: hemophilia, Down syndrome, cystic fibrosis, and brain…
A: CRISPR(Clustered Regularly Interspaced Short Palindromic Repeats) Cas genome editing technology…
Q: how Inverse PCR identifies genes withtransposon insertions?
A: Polymerase chain reaction (PCR)is the molecular technique that is used in the amplification of…
Q: What are the major considerations in the design of PCR cloning primers?
A: INTRODUCTION Primers It is a short nucleic acid sequence that act as a starting point of DNA…
Q: Cite three examples of an application of PCR (polymerase chain reaction).
A: Three examples of an application of PCR (polymerase chain reaction) - 1. Amplification of the DNA /…
Q: Outline a PCR-based approach to screen for colonies transformed with recombinant expression plasmid…
A: In order to select for colonies which are recombinant and contain the plasmid DNA can be separated…
Q: Briefly present experimental and practical benefits of using PCR in DNA cloning process. Give some…
A: The DNA Cloning is the production of a large number of identical DNA molecules from a single…
Q: how can PCR products be labeled using fluorescence?
A: Polymerase Chain Reaction (PCR) is a molecular biology technique that is used for various purposes…
Q: Briefly explain how a gene can be isolated through positional cloning.
A: A positional cloning is a technique used in laboratory for locating the position of a gene…
Q: Describe the important features of cloning vectors. Explain the purpose of selectable markers in…
A: Cloning vector refers to small piece of deoxy ribonucleic acid (DNA), which are used to propogate…
Q: For each of the following experimental goals, is PCR orgene cloning preferable and why?a. Isolate…
A: Introduction The polymerase chain reaction (PCR) is a widely used method for rapidly making millions…
Q: Name the five key tools for accomplishing the tasks of recombinant DNA technology.also mention the…
A: Recombinant DNA technology is a process of joining of DNA molecules of two different species. This…
Q: Differentiate between a PCR cycle and step, and define the function of each of the three steps used…
A: Polymerase chain reaction or PCR is a technique applied on DNA. DNA is a polymer of multiple…
Q: List the advantages and disadvantages of using plasmids as cloning vectors. What advantages do BACs…
A: Cloning vectors are small DNA pieces that are maintained stably in an organism. This vector can a…
Step by step
Solved in 3 steps
- File guft 1.yt Machine Cochise14ee7 Lane 0 Pmer. DTarPOPD mob Comment 17703 Spacing 15.06 Siga C 17A 4 G 2 Bases 0 an 2004 Gelstat ime123 219 20 30 60 70 NNACTCA TCTOGTGGA TTC CTA TCCTG AC A AG TGATGTG CAAAC TG GTAACTC TG AG GCAGATAAC CA G GG CA AA AAGGTG TATAAG 100 110 140 100 CAGA AG TC CGGA AA A TCA TT TAA 170 TAAA ACA AAGCCCTAACT TG GAAG AAGT TCA GTTTTACACA TCT TTA TA TG GAGAGAA 180 TAT TCTAT TA ATOTCCTGT TA TATT TG TCA TATTCA TA CAGT TGTCACAGTATATT TCAAAC CA AC TG TTTAAAA ACAAAC TO AAATAAA 210 230 240 260 270 AAATTTAAATACCCT TA TG TA AA ATAG GCT TC CC TG GTG GCTCAG GG GTAAAAA ACTCGC CCGC CA ACGCAG GAGATGTAGAT TTGATC CCT 300 310 340 350 410 430 440 GG GT TAG GA AG icCCTa GAGA AGGAAATGAAAAAC CACTCTAG TAT TCT Tac CTG GG AAATC CCA TGGACAG AG GAGCOTO GAG G Gc 490 500 SI0 530 TACAGTCCATGGGAGTCGCAA A AGAGT TG GACATG ACTAA ACA ACAACATATAAAATAACCT TACTC CATAATGTCAAACT TATOTCACAC S40 AAA ATGCAA AGT TCT TACATCTAT TAACTTTTATGOT TAAATATA ACCTAATGCACTOTTT TATACAGCA ACAACTACT TT TT TATTT TAAA…A client has been ordered methyl Pprednisulune 30omg luPB In 30mL D5W Over 15 min.stat fur an asthma att-acis. in Stous,you have methylpredrisolune 500mg vials . The reconstitutiun Instructions are: Add 7.8mL G Sterile uater and shale genly Each reconstituted uial contains 8mL. a) Houw nmuch medieation will you draw up? 6) what is the Infusion rate in mt/ hr ?les/test/tq.php?testid=2804&strandid%3D&element%3D&difficulty=assessment&assignment_id%3D45196931&load_test%-D1&teacherPr B Brainly.com-For st.. O Instagram N Netflix a Escape Room (Und. USATestprep, LLC - E Google Docs Stu wrerhd.cells at rer rote due to the siiple diffsion of Save C) 01ann suan an sianua LUPInaPLiaipaih ep snan aun aAPa IM JaPAA active transport. Glucose molecules will move from the cells into the solution in the beaker D) through facilitated diffusion. When examining the major macromolecules in the cell, a student isolates two molecule types that are directly responsible for cellular energy. A comparison of which molecule types will be most likely to include the molecules primarily responsible for cellular energy? A) proteins and lipids B) carbohydrates and lipids proteins and carbohydrates D) carbohydrates and nucleic acids Proteins and polysaccharides are polymers. These polymers are formed by dehydration synthesis. Which statement correctly identifies a…
- Σ P UTF-8"Chapter 12 Solutions 202 x 02-xythos.content.blackboardcdn.com/5b19550bob538/10621560?X-Blackboard-Expiration3=D1649052000 DWorksheet.docx Edits will not be automatically saved. aved changes MOu a Garamond 14. B. 三: 三 山 8. When placed in each of the following, indicate if a red blood cell will 1) not change 2) hemolyze 3) crenate 5%(m/v) glucose solution 1%(m/v) glucose solution 0.5%(m/v) NaCl solution 2%(m/v) NaCl solutionmead. Post Lab #2 Smear & Stain Preparation Name: Leidiawa MontaNo Date: 1. Why are thick or dense smears less likely to provide a good smear preparation for microscopic evaluation? Please explain. Becapse, it will diminish the amount ds latcan Pass through by mam 1t difficult to See under the micioscol e, s less liket to Prowde a go image. 2. What could potentially happen if you leave the slide exposed for too long to the open flame? Why do you have to be careful? we can form ring Patterns if we expose the slide for ta0 the flame 3. During the preparation of a smear leading into simple staining of the bacterial culture S. epidermidis you forgot to heat fix the slide. What would you see on this slide as compared to a slide that was properly prepared? Please explain. 4. You partner stained bacterial cells and saw only the background and not the actual cell was stained. Your partner thought this was a mistake. Please explain what type of staining method this is, how it works and why the…d/e/1FAIpQLSfTle9UfP15_VUqFI-ACEQd1XBykXv5Lr4dEMQbLJ1d6fCupw/viewform Students subjected three samples of five different molecules to gel electrophoresis as shown in Figure 1 A B C DE +2 3 Wells 4 8. Which of the following statements best explains the pattern seen on the * gel with regard to the size and charge of molecules A and B? 1 point molecules A and B are positively charged, and molecule A is smaller than molecule B. molecules A and B are positively charged, and molecule A is larger than molecule B. molecules A and B are negatively charged, and molecule A is smaller than molecule B. molecules A and B are negatively charged, and molecule A is larger than molecule B. Sign out
- Mailings Review View Help es in viruses. Unless you need to edit, it's safer to stay in Protected View. Enable Editing 6. If the y-intercept of a Lineweaver-Burk plot = 1.91 (sec/millimole) and the slope = 75.3 L/sec, KM equals: a 0.0254 millimolar (mM). b. 0.523 millimolar (mM). c. 5.23 millimolar (mM). d. 39.4 millimolar (mM).od 1 Meet- zpn-oxtp-bxu Unit 2 test - cells, organelles, mer X G In order to deteminie how cells rx A testing.illuminateed.com/assessment/5f765e7b4c2b2eb5078b7842/5f765e7b4c2b2eb5078b7843/1?rldbqn=1 ail YouTube Maps O News (1) Facebook Launch Meeting - Z... TikTok sues U.S. go... i! Spanish Present Pro... embrane, transport fall 2020 D. Water moves into and out of the cell at the same rate since the cell is isotonic to its environment. 7. In carrying out normal activities, cells use oxygen and produce carbon dioxide. The concentration of oxygen is higher in the blood than inside the cell, so oxygen moves into the cell. Similarly, carbon dioxide moves out of the cell into the blood because the concentration of carbon dioxide inside the cell is greater than the concentration outside the cell. How do the small molecules of oxygen and carbon dioxide move through the cell membrane?I need not solution Only ABCD typing plz
- Time point (min) Absorbance of culture at 660nm Approximate cell concentration Approximate # cells in 1mL extract 0 0.298 1.49 x 108 cells/mL 1.49 x 108 cells 10 0.316 1.58 x 108 cells/mL 1.58 x 108 cells 20 0.374 1.87 x 108 cells/mL 1.87 x 108 cells 30 0.429 2.145 x 108 cells/mL 2.145 x 108 cells 40 0.512 2.56 x 108 cells/mL 2.56 x 108 cells 50 0.544 2.72 x 108 cells/mL 2.72 x 108 cells 60 0.607 3.035 x 108 cells/mL 3.035 x 108 cells a. Using these data, prepare a growth curve of this strain ofEscherichia coli (E. coli).b. Estimate the doubling time for this strain of E. Coli. Clearly showhow you estimated this value from the empirical data presented.SMART ll A Or © X39% 011:23 Q1WK2.docx 团: Biotechnology Quarter 1 Week 2 Name (Surname, First Name, Middle Initial): Section (Program – Grade Level – Section): Mini Home Experiment Materials: o perfume o clean drinking glass o water o tomato/kamatis o ginger o salt O sugar o platito o knife Procedure: Set-up A: 1. Open your bottle of perfume and spray it at one corner of your bedroom. 2. Observe what happens after 15-20 minutes. Questions: 1. What happened after 15-20 minutes? 2. What is the reason behind this phenomenon? Set-up B: (Be careful with the use of sharp objects. ADULT SUPERVISION IS ADVISED) 1. Cut two ginger sticks of the same size. 2. Prepare two drinking glass of the same size and fill it with equal amounts of water. Label them A and B. 3. Dissolve three teaspoon of salt in glass B. 4. Place the ginger sticks separately in glass A and glass B. 5. Leave the set-ups overnight. 6. Observe the ginger sticks the next day. Questions: 1. Which is the control set-up? 2. What did…Decumentt-Word Product Activation Failed) Insert Design Leyout Raferences Mailings Revien Vie Office Tab Design Legout Helvetica 12 …,市,。 4 Pinces 21 1 AabbCcD AaBbCcD AaB AaBbCe AabB Aanbcer Aalbcen 1 Normal No Spac Heading1 Heading 2 unter A- Pind Fent Tele Subtitle Sutle im. Paragraph Se Styies teng A Hinge joint G. Flexion, Extension, Adduction, Abduction with minimal rotation M trapezkum to base of M1 B. Enarthrosis H. Rotation N. Occipital condyles to superioi articutar tacet of allas C. Condyloid 1. Flexion, Extension O head of humerus to glenoid fossa D. Pvot J. Gliding P. head of proximal phalanx to base of middle phalanx E Saddle K Flexion, Extension, Adduction, Abduction with no rotation Q radial head to radiat notch F. Planar L Flexion, extension Racromion process to acromial end NONAXIAL UNIAXIAL BIAXIAL POLYAXIAL Type of joint 11 2. 3. 4. 5. la Movement a. a. a. b b. b. Example b. 711 pm ENG