Both the isolation buffer and assay buffer that was used in isolation of mitochondria contained 0.3M mannitol. What was the purpose of including mannitol at this concentration?
Q: Using island biogeography theory, on which island would you expect to find a greater number of…
A: The idea of island biogeography was proposed by Wilson and MacArthur in 1967.
Q: Why should changing the genome of human embryos ( human germline gene editing) not be allowed?…
A: CRISPR is a acronym for clustered regularly interspaced short palindromic repeats. It is a gene…
Q: Dizygotic twins are no more or less genetically similar than are other pairs of ________________.
A: Twins are named so because some of their completely identical features but there are certain…
Q: when it rains why do we see more worms out? Use the scientific method steps to describe why we see…
A: Earthworms are a sign of good soil. These are necessary for the breakdown of organic debris (such as…
Q: when it rains why do we see more worms out?
A: Animal kingdom is a higher kingdom that comprises of eukaryotic organisms. Animal kingdom is…
Q: Multiple Choice Question In an insect sensillum: a. the Semper cell forms the socket. b. the…
A: Introduction:- The sensillum of an arthropod has a sensory organ that protruding from the cuticle…
Q: Physician Edward H. Clarke published a treatise opposing higher education for women (Clarke, 1873).…
A: Dr. Edward H. Clarke's in 1873 had to face severe negative reactions from their opponents when he…
Q: How early man could easily perceive the difference between inanimate matter and living organisms
A: Traditionally, when we try to define life, we look for specific traits that living things exhibit.…
Q: mitosis
A: Mitosis: It is defined as the process of cell duplication where one cell divides into two…
Q: Ture or False: (T/F) A bee would detect the odor of the flowers using trichoid sensilla located on…
A: True True False
Q: Crossing over is an event occurring during metaphase II. True False
A: Crossing over is a cellular process that happens during meiosis a special type of cell division that…
Q: Matter is continually recycled between abiotic and biotic components of Earth's ecosystem in…
A: The nitrogen cycle is the biogeochemical cycle by which nitrogen is converted into multiple usable…
Q: 20. Record the type of test used to test for the following organic compounds and what result…
A: To determine whether organic chemicals are present, straightforward chemical tests can be performed…
Q: If a liver cell in an insect contains 24 chromosomes, how many chromosomes are found in its sperm?…
A: Gametogenesis is a specific interaction through meiosis where gametes are produced. The gametes…
Q: Barn Owls produce 2 pellets per day. Assume each pellet contains 80g of biomass. Also assume that…
A: Given Barn owl produces 2 pellets per day. Each pellet has 80 gram of biomass. 40 gram vo le can…
Q: 11. How are metaphase 12. If cells in the process of dividing are subjected to colchicine, a drug…
A:
Q: Selection confers a reproductive advantage to individuals based on their adaptations, and therefore…
A: When reproduction takes place, the two types of gametes are coming together and form a zygote which…
Q: Receptor 1 Receptor 2 Drug A 8.0 7.8 Receptor 5.2 3 Drug B 8.5 PA value 6.4 Drug C 3.1 6.5 10.5 6.5…
A: The transfer of medicine from the administration to the bloodstream is known as absorption. The drug…
Q: Discuss salient features of protozoan
A: Protozoans are the tiny, unicellular and microscopic organisms that contains complex structures with…
Q: Which hormone and condition are mismatched? a. growth hormone-acromegaly b. thyroxine-goiter c.…
A: We know that the Endocrine gland is a gland that liberates its secretion into the blood rather than…
Q: airways clean. ribosomes cell walls cilia vacuoles microvilli present on the cells of our trachea…
A: Explain;- Cilia line the trachea as well, removing foreign particles and fluids from the airway and…
Q: Homozyogous wild type male Drosophila PPQQRRSSTTUUVV (all linked) are irradiated to induce the…
A: Genes are small units of heredity, a different version of the same gene is known as its allele.…
Q: What can be done at home to reduce the amount of bacteria on food?
A: Bacteria These are single-celled prokaryotic organisms that are present almost everywhere. Some…
Q: why is it more advantageous for the cell to have its DNA fused to the cell wall as opposed to…
A: DNA is the nucleic acid present in majority of the organisms,ranging from prokaryotes to eukaryotes.
Q: Phytonadione, also known as Vitamin K1, is required by the body for the modification of certain…
A:
Q: Discuss how global warming might make it harder for the wind/currents to mix the different ocean…
A: Methane gas is produced by microorganisms that break down plant and animal material. This is a…
Q: An individual with an energy expenditure of 30 L of O2/mile and an RER of 0.2 would have to run how…
A: There is a non-linear courting among strolling pace and price of calorie burn. Essentially what this…
Q: Explain in your own words what is the environmental significance of pH.
A: pH is a very important tool for assessing the acidity or alkalinity of a substances.
Q: where are the bacteria that did not take up the plasmid during the transformation
A: Introduction : The technique of horizontal gene transfer known as bacterial transformation allows…
Q: Discuss physiology of protozoan
A: Protozoans are the unicellular eukaryotic organisms that can be considered as free living or…
Q: The hard, often massive rock-like structures of stony corals are actually exoskeletons comprised of…
A: Anthozoa is a class of marine invertebrates which includes variety of animals like stony corals, sea…
Q: ►Describe the effects of enzyme concentration on enzyme activity
A: Every step in the biological process depends on enzymes. They catalyse the sequential reactions…
Q: The difference between asexual and sexual reproduction is that O A. asexual reproduction occurs only…
A: The generation of descendants can be referred to as reproduction. Asexual reproduction is one of the…
Q: Vaccine mandates are often justified as necessary to protect public health (and do the most good for…
A: In order to understand what is ethically wrong or right, ethics explores the intellectual…
Q: What are three functions of the cell nucleus? What are two functions of a plant cell vacuole?
A: Introduction: Nucleus: The largest and most noticeable organelle inside the cell is the nucleus. The…
Q: Types of life-threatening arrythmias in adults
A: Arrhythmias is generally due to very low potassium or magnesium or it is associated with…
Q: Which Scyphozoan life stage performs sexual reproduction? Gemmule Planula Scyphystoma Medusa Ephyra
A: The members of Class Scyphozoan are marine and mainly consist of jelly fishes.The life cycle of…
Q: Which of the following statements are is true about the distribution of hermatypic corals? They…
A: Corals are created by organisms from the Phylum Coelenterata Coral reef is a habitat to many other…
Q: a. Give the three-letter and one-letter names of the amino acids in each oligopeptide starting from…
A: A peptide (peptide bond) is an amide linkage formed by the reaction between the α-carboxyl group of…
Q: Couple 2 PKU heterozygote (carrier) PKU homozygote Couple 1 B. Can couple 3 have a child that has…
A: Since couple 1 who are not affected have affected children - one male and one female, the mode of…
Q: Do you think that most plant and animal cells are similar to does we observed today?
A: Since you have asked multiple questions we will answer the first question for you. If you want any…
Q: Discuss the importance of international agreements in the management of biomedical waste
A: Biomedical waste: It is any waste that is generated during the diagnosis, treatment, and…
Q: endocytosis pinocytosis symbiosis exocytosis keratosis A macrophage is engulfing bacteria through…
A: Introduction :- Macrophages are immune cells that reside or are infiltrated inside tissues and are…
Q: Briefly explain how multi factorial variables in the environment act concurrently
A: A set of observations, each described by several different sets of variables, is subjected to…
Q: What do you understand by cis & trans regulations? Describe.
A: Cis and Trans are the regulatory element which play a important role in gene expression.Promotres,…
Q: Draw the two dipeptides formed from each pair of amino acids. a. tyrosine and lysine b. threonine…
A: Amino acids are the structural unit of proteins. Amino acids (same or different) join with one…
Q: An E. coli colony grew on minimal medium supplemented with arginine and leucine. However, bacteria…
A: Introduction :- The coliform bacterium Escherichia coli, usually known as E. coli, belongs to the…
Q: Compare and contrast between intrachromosomal translocation and unequal crossing over
A: The study of genomes' structure, functioning, evolution, sequencing, and editing is the emphasis of…
Q: Fill-in (complete each statement with the correct term) 1. The are three passages, each forming a…
A: Human anatomy is the scientific study of mature human morphology. There are two categories within…
Q: Inhibitory interneurons associated with the reflex arc are turned on by glutamate. Group of answer…
A: The brain is the primary organ of the nervous system, accountable for receiving and interpreting…
![50% 110 min 47 secs
Both the isolation buffer and assay buffer that was used in isolation of mitochondria contained 0.3M mannitol. What was the purpose of including
mannitol at this concentration?
223 ¶¶ 2 PP GƏ
Typed answer only and also detailed
explanation.
by ProPros
Create a Q](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2Fedbd0a5d-0e43-41b1-a3de-4c5dcfca7a91%2Fb5d53d12-91a8-4820-8ac8-7a4f31a57c4d%2Fru58nf9_processed.jpeg&w=3840&q=75)
![](/static/compass_v2/shared-icons/check-mark.png)
Step by step
Solved in 2 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- P 12 D 12 D. cold bet.p + Who bet P Frien roblc Hom S STAR + ays/1089903/lessons/1533963/variants/2428136/take/15/ A e * Practice TEXT ANSWER Answer the following three questions based on the diagram below. 1. Which of the pictured organisms is a eukaryote? Explain your answer using evidence from the diagrams. 2. Describe two similarities between the cells of prokaryotes and eukaryotes. 3. Describe one difference between the cells of prokaryotes and eukaryotes. You may not use the evidence you described in the first question. Amoeba Bacterium DNA Nucleus (Na to scales Write your answers using 3 to 4 complete sentences. H. = = = = S x, x E E A A Normal BIUS Enter your answer here 22222222 All Changes Saved ons Answered 52°F ClearRabbits were in injected with [32 P] photsphate intraperitoneally ans asacrificed after 2, 5, 8, 12, 18, 24, 48, or 168 hours of radioisotope administration. DNA, nuclear RNA (nRNA), and cytoplasmic RNA (cRNA) were prepared from the kidneys and their specific activities (radioactivity/ mg of nucleic acid) were determined 1. what can be concluded from the nRNA and cRNA curves and why 2. why didn thte specific acitivies of nRNA's and cRNA's decrease significantly after 2 days of labeling.1:55 .ll 0.52 KB/S 56 1.pdf CHEM 3141: BioChemistry Quiz no. 1- Answer key I.) Draw the following compounds. 1.) Maltose: 2 Glucose, a-(1,4) 2.) Gentobiose: 2 Glucose, B-(1,6) 3.) C-2 epimer of Talose 4.) C-3 epimer of Fructose 5.) C-2 epimer of ribose II. Predict the products of the following reactions, if there is none, write NO RXN. Also indicate, if the reaction is fast or slow он FO HO -H H -OH но. + Resorcinol/dilute HCI 1.) 2.) Sucrose + Copper (II) Acetate/Acetic Acid HO H HO H HO H H OH 3.) HO + Orcinol/HCI
- Rabbits were in injected with [32 P] photsphate intraperitoneally ans asacrificed after 2, 5, 8, 12, 18, 24, 48, or 168 hours of radioisotope administration. DNA, nuclear RNA (nRNA), and cytoplasmic RNA (cRNA) were prepared from the kidneys and their specific activities (radioactivity/ mg of nucleic acid) were determined 1. what process was studied in this expereiement 2. What is concluded about the division of kideny cells during the time of labeling and why.Answer: giycogen Time left 0:4T:- If you have got the following DNA template molecules, which one of them will require more energy to break down the hydrogen bonds between the antiparallel strands? O a. GCGCGCGCGCGCGCGCGCGCG O b. GGGGGCCCCCAATTCCCCCCC O c. AAAAAATTTTTCCCCCGGGGG O d. ТAСТАСАСTGTGGTTAАТТААА Oe. АТАТАТАТСGСGTTAAATTCTА CLEAR MY CHOICE Match the given words with the most suitable words from the given list. Unicellular fungi Hyphae Choose... Охуgen Atom ENG سطح المكتب2.58. Bacteria have equivalent diameters of 2 × 10-6 m and densities of approximately 1 kg/L. Under optimal conditions, bacteria can di- vide every 30 min. Determine the mass of bacteria that would accumulate in 72 hr under continuing optimal growth conditions. Can this occur? Explain.
- for the table just do the results and discussion for phosphatw. Table 2. Presence of Nucleic Acid Hydrolysis Products in DNA Hydrolysate Component Tested Diagnosis (+/-) Purine Bases Ribose Deoxyribose Phosphate Sample DNA test solution Distilled water DNA test solution 1% ribose 1% glucose DNA test solution 1% ribose 1% glucose DNA test solution 1% ribose 1% glucose for the photos: use it for the DNA extractiom results. Glucose Below. results during the experiment 8. Test for phosphate on the DNA hydrolysate Sample DNA hydrolysate Ribose Observations (describe what happened) From clear white to light yellow with white precipitate From clear white to cloudy white and no formation of precipitate. From clear white to pale yellow and no formation of precipitate. Diagnosis (Positive/Negative?) 1. Observations on the extraction of DNA Write your observations on the space below. (no sentence limit) If you have photographs, attach them at the end of the document. The blended frozen peas were…Electrophoresis A protein required 6.8 min to travel 82 cm to the detector in a 96 cm -long capillary tube with 25.4 kV between the ends. Find the apparent electrophoretic mobility.8:47 ll 5G% 4 Chapter 9 DNA worksheet 2022.d... 2. Write the mRNA transcript from the DNA template in question 1. Remember your enzyme for RNA polymerase must add RNA nucleotides starting with the 5' direction and moving to the 3' direction. So for the MRNA copy the strand of DNA that is 3'-5') 3. Refer to the codon chart at the bottom of the page. Translate the mRNA into a polypeptide using the following rules. (2 points) Direction of translation of mRNA is from 5' to 3'. 1. MRNA codons are read in groups of three nucleotides. 3. Translation must begin at the START codon. 4. the STOP codon terminates translation. 2. THIRD LETTER SECOND LETTER U TulUUU Phe UUC Phe UUA Leu UUG Leu A UGU Cys U JUGC Cys C UCU Ser UAU Tyr UCC Ser UAC Tyr UCA Ser UAA STOP UGA STOPA UCG Ser UAG STOPUGG Tp G CCUU Leu CÚC Leu CỦA Leu CUG Leu AJAUU Ile AUC Ile AUA Ile AUG Met STARTACG ThrAAG Lys GGUU Val GUC Val GUA Val GUG Val CCU Pro CAU His CCC Pro CAC His CCA Pro CAA Gln CCG Pro CAG Gln ACU ThrAAU Asn AGU…
- Justify all answers (show all work). 1. Minor changes in primary structure can have pronounced effects on biological function. Tetrameric hemoglobin, a₂³₂, dissociates into pairs of dimers aß to different extents depending on the protein primary structure. The standard Gibb energies of dissociation of normal adult hemoglobin A and of several mutants have been determined and are listed in the table below. Substitution in mutant Hemoglobin A, normal Richmond Kansas Georgia 102B; Asn → Thr 102B; Asn → Thr 95x; Pro → Leu AG® of dissociation (kcal/mole Hb) 8.2 6.0 65 5.1 3.6 (a) Write an equilibrium expression for the dissociation of hemoglobin tetramer into dimers. (b) For normal hemoglobin and its three mutants (variations) calculate the equilibrium constant for their dissociation from a tetramer into dimers. (c) How do the equilibrium constants for the dissociation of the hemoglobin mutants compare to that of normal hemoglobin?Anglaauk/courses/ 16967/external tools/retrieve?display full width&url=https 1962F2Fcanys-anglia-a ukquiz-Iti-dub pp-g-zinb Re Using the class data below (where the results shown are the averages obtained from each set of individual data; also on practical schedule), find the mean mitotic index for Allium cepa. Please give your answer correct to 2 decimal places (just add the number, with no units). Table 2. Total number of cells in a field of view of Allium cepa, with numbers of cells in prophase (P), metaphase (M), anaphase (A) and telophase( T) Total M A 141 15 3 2 145 21 4 3 146 9 146 13 7 7 5 146 25 11 5 2 147 13 7 5 150 15 10 10 4 154 24 12 3 155 27 11 7 159 25 19 6. 160 22 11 161 16 14 7 166 24 171 18 2 6. 172 25 5 5 6. 175 15 6. 4 2. 177 27 14 7. 5 179 14 10 180 28 2 191 13 4 1. 1 194 12 3. 3 Tvne vour answer 8°C Mostly cloudy A O 4) search 99+ 近Practice Question 2 The beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is underlined and bolded. It also contains an origin of replication (ORI) which is found at position 30. 1 20 ORI 40 60 3'...TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...5' 5'..AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATACCCOCTACGTGATAG...3' promoter A) Assume that replication has been initiated at that ORI. Provide the sequence of the primer that is complementary to the DNA in each of the following positions. Site A - binding to the top strand of the DNA at position 20 – 30 5' 3' Site B - binding to the top strand of the DNA at position 31 – 41 5' 3'
![Biochemistry](https://www.bartleby.com/isbn_cover_images/9781305961135/9781305961135_smallCoverImage.gif)
![Biology 2e](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
![Biochemistry](https://www.bartleby.com/isbn_cover_images/9781305961135/9781305961135_smallCoverImage.gif)
![Biology 2e](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)