Original DNA Sequence: TACAC CTTGG CGACGACT... MRNA Sequence: Amino Acid Sequence: Mutated DNA Sequence #5 TACACCTT G G GACGACT... (Highlight the change) What's the mRNA sequence? What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? 1. Which type of mutation is responsible for new variations of a trait? 2. Which type of mutation does not result in an abnormal amino acid sequence? 3. Which type of mutation stops the translation of an mRNA molecule? NO
Q: What type of mutation occurred to produce the abnormal sequence (nonsense or missense)? Explain your…
A: A mutation is a change in a DNA sequence.
Q: An allele of a gene has the following change in it's sequence ATG GTG CAC CTG ACT CT GTG GAG AAG TCT…
A: During transcription that is the production of mRNA from DNA, only one strand of the DNA is used.…
Q: Consider the following mRNA molecules and the amino acids they code for. The second mRNA molecule is…
A:
Q: You graduate and land a job in a medical genetics laboratory. A particular family has been…
A:
Q: Mutated DNA Sequence #3 T A C A C C T T A G C G A C G A C T … What’s the mRNA sequence? (Circle the…
A: Deoxyribonucleic acid (DNA) is the genetic material of living organisms. DNA provides the…
Q: What is the sequence of the first 10 nucleotides of the transcript of this gene? 5' 3'
A: Transcription is mainly the process of making RNA from gene sequence and transcript is the product…
Q: The following is a list of mutational changes. For eachof the specific mutations described, indicate…
A: Hello there! As you have posted multiple questions, we are answering only the first three questions…
Q: Which example is describing a "nonsense" mutation? O The normal amino acid sequence of a protein is…
A: Nucleic acids are large molecules made up of nucleotides that help to build proteins and to express…
Q: Beadle and Tatum’s BEST contribution to how gene expression is understood can be summarized as what?…
A: Beadle and Tatum were able to confirm Garrod's hypothesis with the help of genetic and biochemical…
Q: I mutation occurs such that the sequence now reads: CTA CTT TTT. A) Transcribe the short DNA…
A: "Genes" are the fundamental unit of heredity. They store genetic information in the form of DNA,…
Q: Silent mutations that occur in DNA are quite common in living cells and usually involve no effects…
A: A mutation is a change that occurs in our DNA sequence, which might occur due to mistakes when the…
Q: Which two of the following gene mutations would have the highest likelihood of causing a severe…
A: Introduction A mutation occurs when the sequence of DNA changes. Mutations can occur as a result of…
Q: Peptic Ulcer, Is this a genetic disease? If so, do scientists know if it is dominant or recessive?…
A: More than 20% of patients show a family history of duodenal ulcers. They drawn were compared with…
Q: Mutated DNA Sequence #2: T A C G A C C T T G G C G A C G A C T What’s the mRNA…
A: Deoxyribonucleic acid (DNA) is capable of adaptation, it is dynamic too. Its nucleotide substances…
Q: 3' -T ACATC T T G G C GAC GAC T-5' Mutated DNA Sequence #1: MRNA sequence? (Circle the change) Amino…
A: 1)DNA - 3'- TAC ACC TTG GCG ACG ACT-5' mRNA - 3'- AUG UAG AAC CGC TGC UGA-5' Amino acid sequence –…
Q: How would you explain gene expression? How is it that a particular genotype is actually expressed as…
A: The central dogma is the flow of information that is carried by a gene that is expressed in the form…
Q: Provide one example of a clinical implication of a “silent mutation” that proven to have an effect…
A: Answer: SILENT MUTATIONS are the mutations in the DNA that do not have an observable effect on the…
Q: he question with gene sequence to predict amino acid sequence.
A: introduction Translation is the process of translating the sequence of a messenger RNA (mRNA)…
Q: Which of the following mutations near the beginning of a gene likely results in numerous amino acid…
A: Any detectable, inheritable, qualitative or quantitative change in the genetic material of an…
Q: Can someone give me a few inherited disorders that are NOT caused by mutations? and if possible,…
A: Tay Sachs disease- Children's with the tay Sachs disease appears healthy at birth but becomes…
Q: Mutated DNA Sequence #1: T A C A C C T T G G G A C G A C T What will be the…
A: Deoxyribonucleic acid (DNA) contains four nitrogenous bases. These are Adenine (G), Guanine (G),…
Q: Some mutations affect changes in protein structure and function that can result in disease whereas…
A: Proteins are synthesized from gene expression. They are coded by the genes and translated to form…
Q: Baby Y has been diagnosed with the Graham-Snavely mutation. This mutation produces a disorder with…
A: Transcription is the process that refers to the formation of mRNA (messenger ribonucleic acid) which…
Q: You want to examine genetic variation in your gene promoter. You sequence DNA from several…
A: Single nucleotide polymorphism; it is a type of genetic variation which can occur throughout a…
Q: When the human genome sequence was finally completed, scientists were surprised to discover that the…
A: Genetics is the branch of biology which deals with genes, heredity, and genome in the organism.…
Q: GCT GAC ATC CTC CTC mutated DNA sequence mutated mRNA sequence…
A: The flow of the genetic information is from DNA to RNA and RNA to protein. This flow of genetic…
Q: Some mutations affect changes in protein structure and function that can result in disease whereas…
A: Hi! Thanks for your question. But as you have posted multiple questions, I am answering the first…
Q: Mutated DNA Sequence #2 T A C G A C C T T G G C G A C G A C T … What’s the mRNA sequence? (Circle…
A: The DNA (deoxyribonucleic acid) is the genetic material of an organism. The DNA is inherited by the…
Q: Which type of point mutation does not affect the resulting protein? a deletion b missense mutation…
A: A mutation is any alteration or change in the sequence of the genetic material (DNA or RNA). A point…
Q: If the codon AAA is mutated to AAG, it still codes for the amino acid, lysine, and the protein…
A: Mutations are the changes in the genes of the cell that causes abnormalities in the structure and…
Q: Which of the following mutations would likely have the greatest negative impact on the protein…
A: Frameshift mutations are basically known as the most injurious changes to the coding succession of a…
Q: A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid…
A: Mutation is defined as sudden inheritable change that occurs in the DNA sequence. It may be…
Q: ow that the human genome has been sequenced, we know that there are fewer than expected protein…
A: The genomes of most eukaryotes including Humans are larger and complex than those of prokaryotes.…
Q: Below is an mRNA molecule in its wild type form. 5’ CCGUACAUGGUGAAAAGUCAAUGACCAAA 3’ An…
A:
Q: Mutation #2: • Change the Mutation to RED TACACC IIGGCGACGACT AUGUGG A ACCG CU G CUGA MET -TRP- ASN…
A: Original DNA sequence TAC ACC TTG GCG ACG ACT mRNA sequence AUG UGG AAC CGC UGC UGAAmino…
Q: Two types of mutations discussed in this chapter are 1) nucleotide changes and 2) unstable genome…
A: The mutation is a change that is due to a change in DNA due to some environmental factors or damage…
Q: Which of the following mutations would be most likely to have the most negative effect on the…
A: Translation is the process of synthesis of protein in the cytoplasm.
Q: Consider a gene sequence whose promoter has acquired a mutation. Although this is a problem, this…
A: Gene expression in organisms is an essential step for their metabolic activities. Often certain…
Q: A woman has an egg with a mutation for the gene that expresses whether the child can produce lactase…
A: Mutation refers to sudden change in the genetic material and is heritable. It may be on chromosomal…
Q: What is Gene translocation? Would a mutation in one of your muscle cells affect your offspring? Why…
A: Mutations are changes in the sequence of nucleotide of DNA.
Q: an adult with a history of tanning has his genome sequenced. The beginning of a protein coding…
A: Mutations are the changes in the genetic sequence that may result in genotypic or phenotypic…
Q: You have 2 genes side by side on a chromosome, gene A and gene B. In your cell your RNASE enzyme…
A: mRNAs that are initially translated may later be temporarily translationally repressed. All mRNAs…
Q: 5'-ATGTCCACTGCGGTCCTGGAAAACCCAGGC-3’ wild-type allele 3'-TACAGGTGACGCCAGGACCTTTTGGGTCCG-5’…
A: The term mutation refers to the alternations in DNA sequences. The chemicals or other substances…
Q: A molecular geneticist hopes to find a gene gene in human liver cells that codes for an important…
A: Gene cloning is the process by which we can develop a cloned gene in molecular biotechnology.
Q: Mutated DNA Sequence #1 T A C A T C T T G G C G A C G A C T … What’s the mRNA sequence? (Circle…
A: T A C A T C T T G G C G A C G A C T.. A U G U A G A A C C G C T G C T G A METHIONINE (STOP) YES,…
Q: Which of the following mutational changes wouldyou predict to be the most deleterious to gene…
A: Introduction :- A mutation is a change in our DNA sequence that happens as a result of errors in DNA…
Q: (AKS 8a, DOK 2) Students in biology classes at MHS have been conducting an experiment that invloves…
A: Genetic engineering technique is the technique of biotechnology in which the required genes are…
Q: Answer the following scenario like you are the experts in the field of genetic engineering. Write…
A: Biotechnology refers to the usage of living organisms or their products to create new products or…
Q: Retrotransposons are nonviral genetic elements that facilitate their own movement within the genome…
A: 1.True Retrotransposons comprise a large portion of mammalian genomes. They contribute to…
Q: AKS 5c1: A researcher is examining the DNA sequences of a group of mice. He notices that in one of…
A: Silent mutation It is the change in the sequence of the nucleootide bases of the DNA. This change…
Trending now
This is a popular solution!
Step by step
Solved in 4 steps
- What type of mutation is this? 1. Which type of mutation is responsible for new varia tions of a trait? Which type of mutation does not result in an abnormal amino acid sequece? Which type of mutation stops the translation of an mRNA molecule? 2. Sickle Cell Anemia Sickle cell anemia is the result of a type of mutation in the gene that codes for part of the hemoglobin molecule Hemoglobin carries oxygen in your red bloods cells. The mutation causes these red blood cells to become stife sickle-shaped when they release their oxygen. The sickled cells tend to get stuck in blood vessels, causing poin ond increased risk of stroke, blindness, damage to the heart & lungs, and other conditions. Analyze the DNA strands below to determine what amino acid is changed AND what type of mutation occurred Normal hemoglobin DNA A G TC Normal hemoglobin mRNA val• Hisolelo thr•proo Gll Normal hemoglobin AA sequence CA cGT AG A CTGAGG AC AC Sickle cell hemoglobin DNA Sickle cell hemoglobin mRNA Sickle cell…Part II. Give what is needed. |Original DNA Sequence: TACACCT T G G C G A C G A C T MRNA Sequence: | Amino Acid Sequence: Mutated DNA Sequence #1: T A C A T C T T G G C GAC GA C T What's the mRNA sequence? (Circle the change) What will be the amino acid sequence? . Will there likely be effects?. What kind of mutation is this? Mutated DNA Sequence #2: T A C G AC C T T G G C G A C G AC T What's the mRNA sequence? (Circle the change) What will be the amino acid sequence?. Will there likely be effects?. What kind of mutation is this? Mutated DNA Sequence #3: T A C A C C T T A G C GAC GA C T What's the mRNA sequence? (Circle the change). What will be the amino acid sequence?. Will there likely be effects? | What kind of mutation is this? Mutated DNA Sequence #4: T A C A C C T T G G C GACTAC T What's the mRNA sequence? (Circle the change), What will be the amino acid sequence?. Will there likely be effects? - What kind of mutation is this? Mutated DNA Sequence #5: T A C A C C T T G G G A C…1. Transcribe and translate the mutated DNA sequences, CIRCLE the mutation, and classify each type of mutation as either Deletion, Insertion, or Substitution AND the effects of the mutation as either frameshift, missense, silent or nonsense. ۷۷۷۷ Original Sequence: mRNA sequence: Amino Acid Sequence: MET-TRP – ASN - ARG - CYS - STOP Mutated Sequence #1: mRNA Sequence: Amino Acid Sequence: Type of Mutation: Mutation Effect: Mutated Sequence #2: mRNA Sequence: Amino Acid Sequence: Type of Mutation: Mutation Effect: TACAC CTT G G C G A CG ACT AUGUG GAA C C G C UG CUGA TACAT CTTG G C G A C G ACT TAC GAC CTT G G C G A CG ACT First base of codon C A UUU UUC UUA UUG CUU CUC CUA CUG U AUU AUC >Phe Leu >Leu ACU ACC AUA ACA AUG Met ACG GUU GCU GUC GCC GUA GCA GUG GCG lle Second base of codon C A - Val UCU UCC UCA UCG CCU CCC CCA CCG >Ser >Pro Thr Ala UAU UAC UAA UAG CAU CAC CAA CAG AAU AAC AAA Lys AAG LYS GAU GAC Asp GAA >Glu GAG З туг >His G UGA UGG CGU CGC CGA CGG AGU Asn AGC- AGA AGG. GGU GGC…
- 1. A monogenic disease is a disease caused by a mutation in a single gene. For instance, sickle-cell anemia is caused by a mutation in the HBB gene, which codes for the B- globin chain of hemoglobin. The beginning of HBB is shown here: 5'-ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACT...-3' A. Translate this HBB sequence into an amino acid sequence. B. In terms of amino acids, what is the result of the sickle cell mutation, wherein the bolded red A is changed to a T? This single mutation causes hemoglobin to aggregate, causing red blood cells to deform into a sickle-like shape rather than the normal “biconcave disk" shape. C. What would happen if the bolded blue A were mutated to at T? (This is hypothetical; it's not a mutation found in sickle-cell disease.)DNA Sequence: TAC TCC GGC TCT CCC AGT TGA ACT Mutated Sequence: TAC TCG GCT CTC CCA GTT GAA CT Original Amino acid: Mutated Amino Acid: What mutation have occurred in the sequence? How does it affect the expression of amino acids? 2. DNA Sequence: TAC TCC GGC TCT CCC AGT TGA ACT Mutated Sequence: TAC TCT GGC TCT CCA AGT TGA ACT Original Amino acid: Mutated Amino Acid: What mutation has occurred in the sequence? How does it affect the expression of amino acids? 3. DNA Sequence: TAC TCC GGC TCT CCC AGT TGA ACT Mutated Sequence: TAC TCC GGC TCT CCC ACT TGA ACT Original Amino acid: Mutated Amino Acid: What type of mutation has occurred in the sequence? How does it affect the expression of amino acids? 4. DNA Sequence: TAC TCC GGC TCT CCC AGT TGA ACT Mutated Sequence: TAC TCC GGC TCG CCC ACT TGA ACT Original Amino acid: Mutated Amino Acid: What of mutation mutation has occurred in the sequence? How…6. The starting sequence of a gene changed from AUGTTCGACGTG, to AUGTTTTCGACGTG What type of mutation is this? To answer the question, please explain: I) what the mutation is? 2) what types of mutation do you know? 3) what are the possible outcomes of mutations? 14
- A gene affecting the behavioral outlook of individuals was discovered in several humans who can overcome anxiety caused by life's problems. Part of the gene that į translated into protein has a sequence 3'-GGATCCCGAATGTAATGCGTGCTC AATGGTAGTACGGC-5'. 1. What is the complementary strand of the DNA? 2. What is the sequence of the MRNA product after translation? 3. What is the sequence of the peptide encoded by the portion of the gene? (Use one letter symbol of amino acids)1). In the absence of this enzyme, a substance called ceroid lipofuscin accumulates in lysosomes in the brain, resulting in seizures, blindness, decline in cognitive function and motor skills, dementia, and death by the late teens or early 20’s. The TPP1 gene is 6695 bp in length. Think about the characteristics of Batten disease, and then suggest an approach to gene therapy that might be effective for this specific genetic disorder. You may assume that your research team is working in the U.S. and your research is funded by a grant from the National Institutes of Health (NIH). Please EXCLUDE the use of CRISPR from consideration. A. Will you use germline or somatic cell gene therapy? Please NAME and DEFINE the form of gene therapy selected, then explain WHY this is the most appropriate choice.1). In the absence of this enzyme, a substance called ceroid lipofuscin accumulates in lysosomes in the brain, resulting in seizures, blindness, decline in cognitive function and motor skills, dementia, and death by the late teens or early 20’s. The TPP1 gene is 6695 bp in length. Think about the characteristics of Batten disease, and then suggest an approach to gene therapy that might be effective for this specific genetic disorder. You may assume that your research team is working in the U.S. and your research is funded by a grant from the National Institutes of Health (NIH). a) Hypothetically, what specific type of VECTOR will you use to perform your gene therapy? Please select from the following list of potential vectors: disabled retrovirus, adenovirus, adeno-associated virus (AAV), or herpes simplex virus (HSV), then give two reasons why this specific vector is the most appropriate for your gene therapy. Please explain why you were able to rule out the other potential…
- 1). In the absence of this enzyme, a substance called ceroid lipofuscin accumulates in lysosomes in the brain, resulting in seizures, blindness, decline in cognitive function and motor skills, dementia, and death by the late teens or early 20’s. The TPP1 gene is 6695 bp in length. Think about the characteristics of Batten disease, and then suggest an approach to gene therapy that might be effective for this specific genetic disorder. You may assume that your research team is working in the U.S. and your research is funded by a grant from the National Institutes of Health (NIH). Other scientists have suggested that it might be possible to use CRISPR to treat this genetic disorder in affected individuals. (i) First, what is CRISPR? (BRIEFLY describe what it is and how it works). (ii) Briefly describe how CRISPR could be utilized in treating genetic conditions such as Batten disease.2 I 3 4 5 6 I 7 Sickle cell hemoglobin DNA CACGTAGACTGAGGACAC.. sheet: Deletio... obin DNA C A... globin DNA C... Sickle cell hemoglobin mRNA: Sickle cell hemoglobin Amino Acid sequence: 4. What type of mutation is this? Please explain why.4e. You also study the expression of 3 different mutants for this gene. For each mutant answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 5'...TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...3' 3' ...AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATACCCCTACGTGATAG...5' * promoter