Q: 417 ash Course Biology #7 - ATP & Respiration 1. Cellular respiration is how we derive energy from…
A: Respiration is the biochemical process in which the cells of an organism obtain energy by combining…
Q: Describe in detail the relevance of apoptosis to cancer therapy
A: Apoptosis or programmed cell death It is a highly regulated process that allows a cell to self…
Q: QUESTION 3 You are a clinical geneticist who is evaluating a newborn female child with a congenital…
A: The female child has two X chromosomes and 44 Autosomes. The number of barr body is determined by…
Q: 4. Describe the process of alternation of generations using any plant phylum as an example. In your…
A: Introduction :- In plants and algae, the most common type of life cycle is generational alternation.…
Q: How many amino acids would there be in the protein produced from the following mRNA molecule ?…
A: 1. Stop codons- UAA, UAG and UGA. Codon consists of 3 nucleotides. There are 11 codons, but 10…
Q: 1. Along the coast of Vancouver Island in British Columbia, Canada consists of intertidal zones…
A: Introduction The term "population" usually refers to the number of people living in a specific…
Q: I. lipase II. hydrochloric acid III. pepsinogen A. I only В. I only C. I and II only D. II and III…
A: Gastric juice is secreted by the stomach wall when stimulated by the hormone gastrin. When initially…
Q: 2. Why is oxygen when unbound to any other material can be toxic to life? 3. What is the role of…
A: 2. By its proclivity for univalent reduction, which results in the production of reactive oxygen…
Q: B 1. Name the region of the hair labeled A. 2. Name the structure labeled B. 3. Name the specific…
A: Hair Hair is a thread like strand grow on the skin of the mammals and some other animals.
Q: how should we prepare for the next pandemic? What project that can be implemented to avoid future…
A: Introduction Pandemic:- A pandemic is the worldwide spread of a new disease, It is a disease…
Q: Mike is a 34-year old male who reports to the ER after a motorcycle accident. MRI results show that…
A: In a person that has transected spinal cord injury between T1 and L1, it would have paraplegia.
Q: Fetuses whose cells are triploid, that is, contain three full sets of chromosomes, develop to term…
A: INTRODUCTION The DNA molecule is packed into thread-like structures called chromosomes in the…
Q: Albinism is homozygous recessive (aa). A sister with normal coloration has a sister that has…
A: Albinism is a disorder of autosomal recessive inheritance. Albinism inhibits melanin production,…
Q: What is the principle behind a UV-Vis spectrophotometer, and what are its key components, and how…
A: UV-vis spectrophotometry or UV spectroscopy types of absorption spectroscopy or reflectance…
Q: What are some theories or causes of narcolepsy along with the the treatment or therapeutic methods…
A: Narcolepsy is derived from the greek words "narco," that means numbness, or stiffness, and "lepsy,"…
Q: Kernel color in wheat is controlled by 2 pairs of genes (AABB). Determine the color of each…
A: The inheritance of kernel color in wheat is controlled by two genes. These are A and B genes.
Q: What are the importance tof ants o other organisms and to the environment
A: The ant is one of the world's most strongest animals comparable to its size. A single ant can carry…
Q: DNA Sequence Enter DNA sequence below Original sequence ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG…
A: DNA contains the genetic information about the characteristics features of te organism present in…
Q: 4. The difference in charge between the outside and the inside of a neuron at rest is called: A.…
A: Introduction Membrane potential:- It is a potential gradient that forces ions to passively move in…
Q: What is a TED talk? TED stands for "Technology Entertainment
A: TED is a global community, welcoming people from every discipline and culture who seek a deeper…
Q: Can these two concepts apply to the relationship between polar bears and humans & if so, how ? : 1)…
A: The polar bear is a hyper-carnivorous bear whose native range lies within the Arctic Circle,…
Q: - Coronary arteries route oxygen rich blood into the tissues of the heart. of the: d. descending…
A: Two major coronary arteries branch off from the aorta. They branch off from a point where aorta…
Q: Can these two concepts apply to the relationship between polar bears and humans & if so, how ? : 1)…
A: There are different kind of interactions occurs in diverse organisms in the environment;which affet…
Q: 1) A molecular biologist creates a form of RNA polymerase that has the same proofreading ability as…
A: A polymerase is an enzyme that helps to synthesizes long chains of polymers or nucleic acids. It…
Q: To explain: The way in which the plants with nodules for nitrogen-fixing bacteria might…
A: Answer--- Nitrogen fixing bacteria are organisms that are able to convert atmospheric nitrogen into…
Q: 1. Name the structure labeled A (there are several in this image). 2. Name the specific tissue that…
A: The diagram shows the layers found in skin. The skin is the largest organ in the body. There are…
Q: 1) A molecular biologist creates a form of RNA polymerase that has the same proofreading ability as…
A: Proofreading by DNA polymerases avoids translesion synthesis by removing freshly generated…
Q: Compare the auto induction media (AIM) with regular induced protein expression. Which is better when…
A: Most of the eukaryotic proteins are still produced via genetic engineering it into host prokaryotic…
Q: what is structural gene and what is non-structural gene? what is the differences between them?
A: Introduction Genetics is the branch of science that deals with genetic material like genome, genes,…
Q: The most likely site for food contamination is: a) a person's own kitchen O b) the grocery store c)…
A: Introduction Food contamination:- It refers to food that has been corrupted with another substance –…
Q: Where are proteins for export produced? A. Golgi apparatus B. Rough endoplasmic reticulum C.…
A: Proteins are the macromolecules ; which are made up of amino acids.These proteins play very…
Q: One of the challenges faced by animals when moving from an aquatic environment to a terrestrial…
A: Name- Dolphin, Phylum it belongs to - Chordata . Adaptations- structural adaptations- they have…
Q: A group of 3 nucleotides codes for one amino acid. How many codons are needed to make the…
A: Translation: The process through which RNA codes for specific proteins is known as translation. It…
Q: To explain: The way in which predator-prey relationship is affected by natural selection.
A: Charles Darwin was an English naturalist who was interested in outdoor activities from a young age.…
Q: What is Enterobacter aerogenes? What did Enterobacter aerogenes cause? How do you know that organism…
A: There are wide diversity of microbes present in our surrounding;like virus; bacteria;fungi etc which…
Q: 3. What is the difference between homologous and analogous traits? In your answer, describe an…
A: Introduction Evolution is defined as the process by which opportunities arise within an individual…
Q: 1. What are the major adaptations that allow nemertines to thrive in the marine environment? Support…
A: Adaptation: It is a process of evolution that allows any particular organism to be well suited for…
Q: After Eating a pizza Tomatoes and Pizza Dough =Producers – 10,000 or 20,000 Cheese – Primary…
A: The food chain is the arrangement of organisms in a linear sequence in which the nutrients and…
Q: Glomerular filtration is an ATP driven process T or F tubulat secretion is baba effective in…
A: Glomerular filtration It is the first step towards making urine by filtering waste product and…
Q: Animal Diversity Second mouth Symmetrical animals Asymmetrical animals Spiny skin Radial symmetry…
A: These are term related to animal diversity.
Q: QUESTION 8 The mating below shows the sex chromosome found in two parents and their resulting…
A: The fragile X mental retardation protein is encoded by FMR1, which is found on the X-chromosome…
Q: Dekaylen umber of human diseases result from chromosomal abnormalities. Individuals with cri du chat…
A: Cri-du-chat syndrome, often called 5p- (five p minus) syndrome, is a chromosomal disorder caused by…
Q: 23. If the red cockaded woodpecker (Picoides borealis) is unable to eat the southern pine beetle…
A: This is an omnivorous species that feeds on both adults and larvae and eggs of insects. They'll eat…
Q: 1) A molecular biologist creates a form of RNA polymerase that has the same proofreading ability as…
A: Advantage Proof reading ability of DNA polymerase reads the error added codes in DNA and correct…
Q: 43) Topic of Lipids A second big category of lipids are isoprenoids. What are three precursors to…
A: Isoprenoids are a broad class of natural products commonly found in plants and other living beings.…
Q: (Carrying capacity of humans) What is the difference in the carrying capacity of humans with other…
A: Ecosystem balance, often known as "ecosystem homeostasis," is influenced by both factors that tend…
Q: Does Enterobacter aerogenes ferment? Does Enterobacter aerogenes produce indole?
A:
Q: What is the advantage, if any, of direct development in gnathostomulids? 2. What are the…
A: Gnathostomulids is the marine worm while rotifers are multicellular organism.
Q: The following graph depicts the relationship between the mean flower depth of Zaluzianskya…
A: Introduction Evolution is the process of a species' features changing over numerous generations…
Q: 1. What are the amino acids translated from the resulting mRNA?
A: The process of transcription occurs only in one strand of the double-stranded DNA. This strand is…
Hello, Please answer the following attached
*If you actually solve all of the THREE PARTS (QUESTIONS) CORRECTLY AND COMPLETELY, I will 100% leave a thumbs up.
Microbiology Question:
"The attached picture is a
Step by step
Solved in 3 steps with 2 images
- Mycobacterium tuberculosis Diagnostic or detection method(s). Treatment and preventionMycobacterium tuberculosis Type of flagella, number and correctly named arrangement of the flagella (example: monotrichous)Article #1- https://www.livescience.com/47140-ebola-outbreak-causes.html Article #2- https://www.cdc.gov/vhf/ebola/history/2014-2016-outbreak/index.html Video #1- https://youtu.be/4Y7Cq6KEX0M?si=DG0hZLi2f6nbod7z Video #2- https://youtu.be/KULNjM2XEgo?si=n-_FI5-yw_DqKhQO Please read the news and watch the videos above then answer the two question below. Please have the references listed if used any. Thank you so much Questions: 1) For those regions affected by Ebola, and given the explanation for why it was so widespread, what can be done to better protect against future outbreaks? 2) Do any of the news or public reactions remind you of what we've witnessed in 2020 with the COVID-19 pandemic?
- Mycobacterium tuberculosis Geographic regions where the disease is prevalent . include interesting FactsWhich of the following bacteria is the most common isolate from blood? Vibrio cholerae Mycobactererium tuberculosis Mycoplasmapneumoniae Helicobacter pylori Escherichia coli Which of the following bacteria often cause Otitis media (middle ear infections) in children? Mycoplasma pneumoniae Mycobactererium tuberculosis Streptococcuspneumoniae Helicobacter pylori Escherichia coli Which of the following influenza viruses is/are influenza B virus(es)? H1N1 H3N2 H7N9 All of the above None of the aboveWhat genus was the organism that spread through the NIH hospital in bethesda, maryland? pneumoniae stenotrophomonas staphylococcus klebsiella
- Bacillus anthrasis Vibrio cholerae Haemophilus ducreyi Haemophilus influenzaeWoman, virgin, presenting leucorrhoea. What is the suspected infection? how can she have acquired the infection? How to carry out the parasitological diagnosis and how expect to find?A 19-year-old woman presented because of the recent onset of breakthrough bleeding. She has been taking the same oral contraceptive Pill for two years, she has not forgotten any pills or had diarrhea or vomiting. She has been with her current sexual partner for four months and has recently stopped using condoms as additional protection. She is otherwise well. On examination the vulva and vagina are healthy and there is no inflammation. There is a small cervical ectropion and profuse mucus and pus discharge from the cervix. There is no tenderness on bimanual vaginal examination and no masses palpable. An endocervical swab and urine test was administered.
- https://youtu.be/kUlKRIMxpZQ?si=HXom3VXfbwAeMNPl Answer the questions after watching the video above and please cite any other sources that is used. Thank you How do public health officials work together to solve the issues? How do you investigate the outbreak? What do you need to do?Salmonella Typhi Who discovered it? When was it discovered? How was it discovered? Kindly answer in detailed and comprehensive manner.mycobacterium tuberculosis Capsule or not (If yes, describe what is it made from