Which explanation describes how cells are differentiated in multicellular organisms? All genes are always working, but repressor proteins control what tRNA is formed by MRNA. All genes are always working, but chemicals in the cell stop some proteins from forming. All cells have the same genes, but the age of the cell will determine which genes are active. Genes are turned on and off at various times of the cell's life, creating only certain proteins in the cell.

Which explanation describes how cells are differentiated in multicellular organisms? All genes are always working, but repressor proteins control what tRNA is formed by MRNA. All genes are always working, but chemicals in the cell stop some proteins from forming. All cells have the same genes, but the age of the cell will determine which genes are active. Genes are turned on and off at various times of the cell's life, creating only certain proteins in the cell.

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter9: From Dna To Protein

Section: Chapter Questions

Problem 15SA: Put the following processes in order of their occurrence during expression of a eukaryotic gene: a....

See similar textbooks

Similar questions

Put the following processes in order of their occurrence during expression of a eukaryotic gene: a. mRNA processing c. transcription b. translation d. RNA leaves nucleus
Briefly describe the function of the following in protein synthesis. a. rRNA b. tRNA c. mRNA
what is the first event to take place in translation in eukaryotic cell? a. An clongation of the polypeptide chain by the addition of amino acids b. Binding of the larger ribosomal subunits to the smaller ribosomal subunits c. Base pairing of activated methionine-tRNA to AUG of messenger RNA d. The small subunits of ribosome recognizing and attaching to 5' cap of mRNA
The sequence below is DNA from an unknown cell. Use what you know about transcription to infer some things about the cell it came from and the RNA product it will form. Be sure to explain your answer for each question. 5’ – AGATTCAGGTCGAACATTATAGTCCAACTATACGGCGTTATGTCAATCCGCA – 3’ 3’ – TCTAAGTCCAGCTTGTAATATCAGGTTGATATGCCGCAATACAGTTAGGCGT – 5’ Which direction is upstream (left or right)? Possible Answers: A. Right - the promoter lies downstream of the transcription start site B. Left - the promoter lies upstream of the transcription start site C. Right - the promoter lies upstream of the transcription start site D. Left - the promoter lies downstream of the transcription start site
Why siRNA phenomenon is utilized in cell biology? Because specific gene silencing leads to blocking protein translation Because specific gene silencing leads to blocking mRNA transcription Because specific gene silencing leads to blocking DNA replication All answers are correct
How does our body make protein? I This copy - mRNA - travels from the nucleus of the cell to the part of the cell known as the cytoplasm, which houses ribosomes. Ribosomes are complex machinery in the cells that are responsible for making proteins.II. The cell then expresses the protein and it, in turn, carries out its designated function in the cell on the body.III.Through a process known as transcription, an RNA copy of a DNA sequence for creating a given protein is made.IV. Then, through another process known as translation, ribosomes 'read' the mRNA, and follow the instructions, creating the protein step by step a,II-III-IV b,I-IV-II c.II, I, III, IV d,II-IV-I
Give only typing answer with explanation and conclusion which of these choices represents one possible corresponding mRNA sequence that can be transcribed by RNA polymerase, and later translated by ribosomes from the following DNA template? 5'- CTGTATCCTAGCACCCAAATCGCAT - 3'; A. 5'- CTA GCA CCC AAA TCG CAT TAG - 3', B. 5' - AUG CGA UUU GGG UGC UAG - 3', C. 5' - AUG CGA UUU GGG UGC - 3', D. 5- ATG CGA TTT GGG TCG TAG - 3'
How is translation different in prokaryotes and eukaryotes? a. In prokaryotes, because they do not have a nucleus, the translation of mRNA occurs while it is being transcribed b. In prokaryotes, pre-mRNA translation before transcription occurs within the cell c.In prokaryotes, reverse trancriptase simultaneously translates and transcribes mRNAd.In prokaryotes, functional mRNA allows for translation to be skipped, and proteins are made during transcription
Write a sentence describing the role of each of the following types of RNA in gene expression. mRNA- rRNA- tRNA- snRNA-
Which RNA molecule(s) are modified at the 5' and 3'ends in eukaryotes? 1. 2. MRNA tRNA FRNA 3. 4. 5. tRNA and MRNA FRNA and tRNA 6. Which one is NOT a function of the Signal Recognition Particle (SRP) in protein targeting? 1. 2. peptide formation of a 9-12 amino acid long sequence binding to a signal sequence preventing elongation factors binding during translation guiding the ribosome to the endoplasmic reticulum halting translation 3. 4. 5. 7. Which prokaryotic enzyme is equivalent to the eukaryotic Mcm2-7? 1. 2. Primase Helicase or DnaB DNA polymerase DNA polymerase II DNA ligase 3. 4. 5. 8. Recombination is associated with 1. 2. HIV and genome integration. gene therapy involving the use of viruses. generating genetic diversity. Option 1 and 2 are both correct. Option1, 2 and 3 are all correct. 3. 4. 5. 9. Which component of a western-blot allows for the specific detection of a protein of interest? 1. 2. polyacrylamide gel buffer 3. 4. antibodies chromogenic substrate membrane 5. 5.
A scientist observing a cell during gene expression would be able to easily distinguish it as a prokaryotic cell by which of the following observations? Group of answer choices as soon as the DNA introns are removed from the template after the 5' caps are converted to mRNA after a transcription initiation complex has been formed during transcription once the pre-mRNA has been converted to mRNA 2.Scientist wanted to determine what molecule held the ‘gene ‘ if they did a study in which a cell was infected by a virus,which part of the virus actually caused the infection inside the cell!? -Dna -ribosome -protien -Rna
Choose all that apply regarding gene transcription in eukaryotes: Exons are removed from mRNA by the spliceosome. RNA polymerase II must completely finish an mRNA transcript before processing can begin. RNA polymerase I catalyzes the synthesis of the majority of ribosomal RNA. Histone acetylation is a method of controlling gene expression. Acetylation creates more positive charges on histones, leading to tighter binding of the proteins to DNA. Introns must be removed from the initial RNA transcript. The hormone 17beta-estradiol binds to a G-protein coupled receptor to control gene transcription. The 5' cap of mRNA requires the free triphosphate on the nucleotide at the 5' end. Multiple transcription factors are necessary to form the pre-initiation complex (PIC) of RNA Pol II.