As diagrammed below, some amino acid biosynthetic operons have stem loop structures in the mRNA. These structures play a role in the regulation of the operon by which of the following mechanisms? Translation stop codon- Attenuator loop mRNA 5' 3' DNA attenuator trpE O Catabolite repressor protein can bind and prevent the hairpins from forming thus allowing translation to occur. O The leader sequence shown contains codons for the amino acid. When these are low, the ribosome stalls, allowing a hairpin between the two middle regions to form so that the rest of the message can be translated. In the presence of large amounts of the amino acid, the hairpin will wind around the amino acid and prevent further translation. O A repressor protein made of that amino acid will bind to the region and prevent translation when large amounts of the amino acid are present. O The uridine-rich region has codons for that amino acid; when present, this region will be a terminator region. The hairpins allow for an RNA to bind that then allows translation to occur. P Leader peptide coding region U-rich attenuator

As diagrammed below, some amino acid biosynthetic operons have stem loop structures in the mRNA. These structures play a role in the regulation of the operon by which of the following mechanisms? Translation stop codon- Attenuator loop mRNA 5' 3' DNA attenuator trpE O Catabolite repressor protein can bind and prevent the hairpins from forming thus allowing translation to occur. O The leader sequence shown contains codons for the amino acid. When these are low, the ribosome stalls, allowing a hairpin between the two middle regions to form so that the rest of the message can be translated. In the presence of large amounts of the amino acid, the hairpin will wind around the amino acid and prevent further translation. O A repressor protein made of that amino acid will bind to the region and prevent translation when large amounts of the amino acid are present. O The uridine-rich region has codons for that amino acid; when present, this region will be a terminator region. The hairpins allow for an RNA to bind that then allows translation to occur. P Leader peptide coding region U-rich attenuator

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 4CT

See similar textbooks

Similar questions

Lactose permease is encoded by the lacY gene of the lac operon.Suppose a mutation occurred at codon 64 that changed the normalglycine codon into a valine codon. The mutant lactose permease isunable to function. However, a second mutation, which changescodon 50 from an alanine codon to a threonine codon, is able torestore function. Is each of the following terms appropriate or inappropriate to describe this second mutation?A. ReversionB. Intragenic suppressorC. Intergenic suppressorD. Missense mutation
The following is a sequence of the leader region ofthe his operon mRNA in Salmonella typhimurium.What bases in this sequence could cause a ribosometo pause when histidine is limiting (that is, when thereis very little of it) in the medium?5′ AUGACACGCGUUCAAUUUAAACACCACCAUCAUCACCAUCAUCCUGACUAGUCUUUCAGGC 3′
Attenuation of the trp operon is regulated by the efficiency of translation of the trp leader (trpL).A scientist mutates the aminoacyl tRNA synthetase responsible for charging tRNATrp, resulting in1/100 the normal amount of charged tRNATrp. How would this mutation impact attenuation ofthe trp operon? Explain why.
You are studying an operon containing three genesthat are cotranscribed in the order hupF, hupH, andhupG. Diagram the mRNA for this operon, showingthe location of the 5′ and 3′ ends, all open readingframes, translational start sites, stop codons, transcription termination signals, and any regions thatmight be in the mRNA but do not serve any of thesefunctions.
When referring to attenuation in the regulation of the trp operon it would be safe to say that, when there are high levels of tryptophan available to the organism, transcription termination at the attenuator region is likely the ribosomes stall during translation of the attenuator region translation termination of the trp operon is likely the trp operon is transcribed at relatively high levels tryptophan inactivates the repressor protein
Describe the main functional differences between the TRP and the Lac operons. Main functional differences DO NOT refer to the fact that one operon involves TRP and the other involves Lac. They also don’t include that there are different genes found in the TRP operon compared to the Lac operon or that the repressor in the Lac operon is called Lac l. Also DO NOT simply list how both operons work to answer this question.
All of the following statements about the repressor of the lac operon of E. coli are true EXCEPT which one? O A. The repressor is the product of a regulatory gene i The repressor binds to the operator region of the DNA of the lac OB. operon. The repressor is a protein. OC. The repressor interacts with the operator in such a way as to OD. prevent translation of beta-galactosidase. The repressor can combine with lactose to form a OE. complex that will no longer bind to the operator region. QUESTION 32 The amino acid which is a precursor of serotonin is Histidine OA. O B. Tyrosine O C. Glutamate D. Tryptophan O E. none of the above
How will transcription of the E. coli trp operon be affected by the following manipulations of the leader region of the trp mRNA? - Changing several nucleotides in region 3 so that in can base pair with region 4 but not with region 2 - Removing region 4 - Increasing the distance between region 2 and region 3 - Increasing the distance (number of bases) between the leader peptide gene and region 2
Which of the following statements about the trp operon is false? If a mutation in region 2 prevents the formation of the 2 + 3 loop in the 5’UTR transcription levels will increase. The trp operon is an example of negative repressible operon. Formation of the anti-terminator in the 5’UTR of the trp operon occurs when trp levels are low. In the presence of high trp-tRNA, the genes of the trp operon are not expressed. The role of trp is to bind to the repressor protein and activate it.
The dlagram below represents the tryptophan operon with the trp leader MRNA transcript enlarged to represent the AUG transiation start codon, two consecutive tryptophan amino acld codons (UGGUGG), and 4 regions (1, 2, 3, and 4) that base pair to form different hairpin-loop structures in the MRNA leader region. What would happen in this MRNA leader region when cells encounter very low levels of tryptophan in Its environment? Leader region trpE trpD trpC trpB trpA DNA 5' 3' Transcription trp leader sequence mRNA UGGUGG (tryptophan codons) AUG UUUUUU 1 3 4. The translating ribosome would stall at the two tryptophan codons, causing the formation of a hairpin-loop botween regions 3 and 4 to promote transcription of the trp operon. The translating ribosome would stall at the two tryptophan codons causing formation of hairpin-loop between regions 2 and 3, which functions as an anti-lerminator of transcription The translating ribosome would stall at the two tryptophan codons causing formation…
that best fits the phrase below (1-20) Cis-acting B Post-transcriptional modification Post-translational modification Reactive (R) group Trans-acting C Operon Nuclear localizationsignal Double-stranded RIA Shine-Dalgarno sequence Kozak sequence E site on ribosome Ps p riboeE8R3) A site on ribosome Constitutive F Allosteric transition Inducer ll ol g Repressor T G H. Nonsense codon Frameshift mutation W Chaperones Found upstream of AUG codons in bacteria, this binds the 3' end of the 16S rRNA of the 30S ribosomal subunit Addition of chemical groups to amino acids in a polypeptide Hidigel elnw eesel Poly (A) polymerase enzyme uses ATP as substrate to add a string of A nucleotides on to the 3'-OH of MRNA Jeiheg 1ot eninoaso uoy nielgxe 10 anoitamusas Tuoy elsta otehgo1qqs eedW 4 Is produced when both strands of DNA encoding a gene are transcribed simultaneously A class of proteins that arrest incorrectly or incompletely folded proteins 6. Occurs when allolactose binds Lacl protein causing…
Under what condition will there be more transcription initiation of the Trp operon? Low tryptophan O High tryptophan