ANALYSIS 1:Given the following sequence of bases present in the DNA coding strand, what will be the sequence on the template strand, on the MRNA strand and on the peptide? Show the sequence of amino acids if A is inserted between C-6 and T-7. (5') CTT-AGC-TGG-CCC ... (3') Key-in your answers in this manner: template strand (3') XXX-XXX-XXX-XXX (3') MRNA strand (5) XXX-XXX-XXX-XXX (3') Wild-type peptide AA1-AA2-AA3-AA4 Mutant peptide AA1-AA2-AA3-AA4 buse in codon A. G. the Phe Se Se Se Trp He tase n uopos u a

ANALYSIS 1:Given the following sequence of bases present in the DNA coding strand, what will be the sequence on the template strand, on the MRNA strand and on the peptide? Show the sequence of amino acids if A is inserted between C-6 and T-7. (5') CTT-AGC-TGG-CCC ... (3') Key-in your answers in this manner: template strand (3') XXX-XXX-XXX-XXX (3') MRNA strand (5) XXX-XXX-XXX-XXX (3') Wild-type peptide AA1-AA2-AA3-AA4 Mutant peptide AA1-AA2-AA3-AA4 buse in codon A. G. the Phe Se Se Se Trp He tase n uopos u a

Name: ANALYSIS 1: Given the following sequence of bases present in the DNA
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: ANALYSIS 1: Given the following sequence of bases present in the DNA coding strand, what will be thesequence on the template strand, on the MRNA strand and on the peptide? Show the sequence of aminoacids if A is inserted between C-6 and T-7.(5') CTT

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter15: Genes And Proteins

Section: Chapter Questions

Problem 22CTQ: If mRNA is complementary to the DNA template strand and the DNA template strand is complementary to...

See similar textbooks

Similar questions

A. DNA Replication Construct a DNA with 15 base pairs. (Note that the first three nucleofides of the parent DNA (3' to 5') strand correspond to a start codon and its last three nucleotides correspond to a stop codon in its MRNA counterpart later on.) Write it down as follows: a. the sequence of parent DNA (template) 3' A C A TT 5' 3' Upon undergoing DNA replication, show what one daughter DNA molecule will look like. Write it down as follows: b. the sequence of DNA Daughter 1: 3' 5' 5' 3' C. the sequence of DNA Daughter 2: 3' 3' 5' in in
5’-GGC TAC GTA ACT TGA TAA-3’ (a) mRNA codons that are transcribed from the DNA (b) tRNA anticodons for each of the mRNA codons (c) The sequence of amino acids in the resulting polypeptide. (d) Provide the sequence of another possible DNA strand that will lead to synthesis ofthe same polypeptide.
nd 2 minutes): Any RNA polymerase in any organism: O A Synthesizes RNA chains in the 3 to-5" direction O B. Binds tightly to a reqion of DNA located thousands of base pairs away from the transcobed rogion of the DNA OC Has proofreading activity O D. Separates DNA strands throughout a long region of DNA (up to tinousands of base pairs) and then copies one of them. OE Has a subunit called A (lambda), which acts as a proofreading ribonuclease OF. Can initiate synthesis of a new RNA chain without a primer
Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA strand and explain how the strand will be replicated. Where in the cell would this occur? 2. What would be the synthesized mRNA strand, and how is it transcribed from the original DNA strand, and then converted from a pre-mRNA strand to a mature mRNA? Where in the cell does this occur? 3. What would be the anti-codons for the tRNA. What are the amino acids generated based on the RNA. How are these amino acids translated into protein and where in the cell does this happen?
DNA: 5’-CTCTACTATAAACTCAATAGGTCC-3’ Draw a box around the sequence where RNA polymerase will bind to the DNA. What is this sequence called? Will transcription start at this sequence, to the left of this sequence (“upstream”) or, to the right of this sequence (“downstream”)? Draw a small arrow above the DNA strand where transcription will begin. Which DNA strand will RNA polymerase transcribe? Highlight this strand with your highlighter. (Hint: RNA pol is similar to DNA pol because it can only make new RNA in the 5’ to 3’ direction. Draw in an arrow to show the direction that RNA polymerase will move along the DNA strand.
Date: Class: Name: Transcription Questions Answer the following questions. 1. What bases are found in RNA? 2. What bases are found in DNA? 3. Which strand is the messenger RNA complementary to? 4. Which strand is the messenger RNA nearly identical to? 5. What proteins help to direct the RNA Polymerase to the right location? 6. The end of a new nucleotide is always added to the end of an existing strand. 7. Distinguish between the following two terms: chromosome and gene. 8. Scientists have long referred to the DNA between genes as "junk DNA". But as scientists study the genome, they discover new and unique reasons why this DNA is not really "junk". Using internet resources, research 2 functions for sections of DNA in between genes. Describe your findings below. C) 2015 Bethany Lau.
Original sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3
Replication:- what other enzymes are involved in the initiation phase?- explain the role of primers in this phase- how is the building of the leading strand different from that of the lagging strand?
10. A portion of 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence does this code for? To answer the question please: I) explain what is the genetic code and list the properties of the genetic e 2) draw a diagram of protein synthesis; 3) determine which tRNA should be attached to the mRNA; 4) what is the anticodon for the very first tRNA that will attach to mRNA? mRNA molecule has the sequence an
I. What is the correct order of enzyme action during DNA replication? Number the steps from 1 to 7. HINT: Refer to the slide show and video lecture on this topic to help you solve this one: Synthesis of RNA primers (priming) Ligation II. A double-stranded DNA molecule with the sequence shown below can produce a polypeptide that is four amino acids long. Identify which DNA strands are the coding and the transcribed template strands by circling C or T to the left of the table below, respectively. Use an arrow to indicate the direction of transcription. In the table, show the mRNA sequences and amino acids in this peptide. In spaces to the left and right of the table, label all 5' and 3' ends of all relevant nucleic acid strands. READ CAREFULLY: The table gives you the possibility of filling in answers that show transcription from either strand or in either direction. You are only required to fill in the information relevant to ONE PEPTIDE (no others). Refer to the genetic code on the…
Show all work. 1. A) Produce a double-stranded piece of DNA that is 11 base pairs long using the letters A, C, G, T and label the ends of both strands using 3' and 5' appropriately. B) Calculate the ratio of (A+T)/(G+C) and (A+G)/(C+T). Explain why one ratio will always be equal to 1.0?
DNA Replication Drawing Name: Using penci, you will draw a representation of DNA replication along the leading and lagging strands. Follow the directions below, drawing each element in its proper location along the replicating DNA strand. Once you are sure everything is in the correct place, complete your drawing by adding color to distinguish objects as separate. 1. On the diagram below, label the 5 and 3' onds of both parental DNA strands (you can make up which is which) 2 Label the replication fork 3. Draw and label helicase 4. Label the overall direction of DNA replication 5. Draw and label single stranded binding proteins 6. Draw and label the leadng strand 7. Draw and label a single DNA polymerase IIl on the leading strand 8. Draw and label an RNA primer on the leading strand 9. Draw and label a DNA polymerase I on the leading strand 10. On the lagging strand, draw and label at least three Okazaki fragments 11. On the lagging strand. draw and label at least two DNA polymerase IIl…