According to the recent malaria report of the Department of Health, Disease and Prevention Bureau (2022), there are 4, 251 confirmed cases of malaria in the Philippines and majority of the cases are due to Plasmodium falciparum. P. falciparum life cycle includes gametocytes that will aid the parasite to reproduce sexually in its anopheline vectors. Examine Figure 2 below. Provide three (3) qualitative descriptions of the P. falciparum gametocyte. Write your answers in a complete sentence. Fig. 2.. Plasmodium falciparum gametocyte in thin blood smear (CDC, 2022)

Q: To test whether you learned something from this module, answer briefly the following questions…

A: Dyes are used to impart colors to substances. Dyes are of different types which are : (i) Pigment…

Q: List some of the ways that humans use fungi.

A: Introduction :- Fungi can be single-celled organisms or multicellular organisms with a great deal of…

Q: using,   3’ TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG , What would be the resultant type of error…

A: The given sequence is 3'TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG5' The mRNA sequence will be…

Q: . What is Ringworm? What are the different types of ringworm?

A: Ringworm is A highly contagious fungal infection of the skin or scalp. Ringworm is spread by…

Q: humectants as food additives.

A: Food additives Food additives are substances that when added to food increase their flavours, taste,…

Q: Partial 0.75 /1 pts Question 8 Where is carbon stored on Earth? Check all that apply. V rocks and…

A: Carbon is one of the most important elements to humans since all organic compounds and most…

Q: DNA ligases will seal all nicks there are in the DNA strands during the replication process and in…

A: DNA nicks introduced during the process of replication, recombination or repair if left unchecked,…

Q: In a certain African population, 4% of the population is born with sickle cell anemia (aa).…

A: p2 + 2pq + q2 = 1 and p + q = 1 p = frequency of the dominant allele in the population q = frequency…

Q: iscu

A: Answer- Human sexuality is the way people experience and express themselves sexually.Biological,…

Q: Question 22 During RNA chain elongation gyrase proceeds ahead of the transcription bubble in order…

A: DNA gyrase does the indispensable job of catalyzing the ATP dependent negative supercoiling of…

Q: Which of the following is not part of the green revolution? -Irrigation -Mechanization -GMO's…

A: Green Revolution (a term utilized for rapid expansions in wheat and rice yields in emerging nations…

Q: Is meticillin-resistant Staphylococcus hospital-acquired infection? aureus (MRSA) the only major

A: Introduction - Staphylococcus aureus is a Gram-positive, round-shaped bacterium that belongs to the…

Q: Which of the following receptors is most implicated in the energy crisis following a concussion?…

A: A concussion is a type of brain injury that can occur after a blow to the head. Concussions can…

Q: (b) How is ATP converted to ADP by glucose? Explain. Why is of phosphoric acid by glucose? there no…

A: ANSWER) An ATP is converted to ADP by glucose when a phosphate group is removed during the process…

Q: Column A Column B Column C I. a. Spherical/globular A. Epithelial I. b. Striated, multinucleated,…

A:

Q: Is there any interaction between the peptides given below with their single letter abbreviations in…

A: Proteins are made up of amino acids that are linked together by peptide bonds. Usually, in the cell…

Q: A large plant arose in a natural population. Qualitatively,it looked just the same as the others,…

A: Polyploidy occurs when an organism's cells have more than two full sets of chromosomes ( diploid)…

Q: Describe the steps of transcription in bacteria

A: Introduction - In the nucleus, transcription occurs. To make an RNA (mRNA) molecule, it uses DNA as…

Q: 1. Infections caused may fall into one of four categories which vary depending on the site affected…

A: Infections It is defined as the invasion of organism's body cells by disease causing pathogens.…

Q: A team of researchers investigated the effects of phosphorous availability and light intensity on an…

A: Plants produce food through the physicochemical process of photosynthesis, which is a…

Q: . Which of the following statements about the flow of genetic information is correct? A. Translation…

A: Genes are the basic hereditary molecules that carry hereditary information in them. They are present…

Q: Acetylcholine is necessary for the depolarization of skeletal muscle cells. Which of the following…

A: * Acetylcholine is an chemical that functions in brain and body as  neurotransmitter.  *It is an…

Q: The Earth’s atmosphere consists of 78% nitrogen. Why do you think that plants and animals can’t use…

A: Earth’s atmosphere contains a huge amount of nitrogen gas. But this nitrogen is unavailable to…

Q: Use what you know about inflammation to explain how periodontal organisms might be responsible for…

A: Suppose that bacterial plaque builds up in patient's oral cavity (on the teeth). This leads to…

Q: Q.3. Explain the terms: 1. Race 2. Breed 3. Cultivars 4. Variety

A: 1. Race- Different phenotypic populations within the same species may be referred to as a race. It…

Q: . What is aneuploidy? Differentiate between aneuploidy and polyploid

A: Aneuploidy Aneuploids differ from standard 2n chromosome complements in single chromosomes. These…

Q: The subunit in E. coli RNA polymerase which is required for recognition of the promoter sequence is…

A: Transcription is a process by which an RNA copy of the DNA is made. It is an important step in gene…

Q: Which co-receptor molecules are common to both TC and TH cells and their respective antigen…

A: The CD2-LFA-3 and LFA-1-ICAM pathways relevance to T-cell recognition

Q: . Neural communication occurs through chemical messengers called neurotransmitters which send…

A: The structure, functioning, evolution, mapping, and editing of genomes are all studied in genomics,…

Q: Question:- 1. which among this pigments extracted by aceton: (algeas) Phycooyanin Phycoerythrin…

A: Acetone is a liquid solvent that can dissolve and break down other materials. Acetone is used in…

Q: Discuss the scientific approach to human sexuality from a historical perspective.

A: Human sexuality is a term that defines an integral part of the personalities and way of expressing…

Q: You grow cells in the lab in the presence of radioactively labeled oxygen gas. Which cell metabolite…

A: Oxygen is inhaled and is supplied to cells through blood. Oxygen is utilized for metabolism. The…

Q: Which of the following does NOT tend to promote genetic divergence between populations?   a)…

A: The genetic diversity has three different sources: mutation, recombination and immigration of genes.

Q: How can moist heat sterilization can sterilize antibiotic solution?

A: Moist heat sterilization is a technique that uses heated, increased pressure steam to sterilize an…

Q: Electrical impulses travelling from a point of origin to adjacent regions of the cortex is referred…

A: A sudden uncontrollable electrical disturbance on the brain is known as seizure. Causes change in…

Q: c) (i) Draw the potential tautomers of guanine. (ii) Based on Question 1c) (i), label the patterns…

A: Tautomeric forms of  Nitrogenous bases:       The common bases of DNA which are - adenine, guanine,…

Q: Why is Trisomy 21 more common than other trisomies (e.g. Trisomy 1, Trisomy 2, etc.)? The size of…

A: Answer :-(C)   Trisomy 21 are caused by nondisjunction, which occurs when pairs of homologous…

Q: Two haploid strains of S. cerevisae (yeast) are crossed. One has the genotype ABC and the other abc.…

A: Introduction :- A cell with a single set of chromosomes is referred to as haploid. The number of…

Q: Name the four classes of bones? a) Long, short, regular, irregular b) Big, small, flat, bulged c)…

A: Our body' structure is provided by bones. There are 206 bones in the mature human skeleton. The…

Q: Need help on questions 3 and 4, please. Drop-down answer choices are images. Canine Scott Syndrome…

A: 3. TMEM16F splice site mutation segregated with the CSS trait and TMEM16F protein was undetectable…

Q: What is the relationship between the severity of symptoms and the size of the chromosome involved in…

A: More the size of the chromosomes involved in the trisomy, more will be the severity of symptoms.…

Q: Explain why the genetic code is redundant

A: Introduction :- The genetic code is made up of codons, which are three-letter nucleotide pairings…

Q: Having the ability to degrade the DNA allows the DNA polymerase to perform its job properly and…

A: Answer :- True. - It is true that having the ability to degrade the DNA allows the DNA polymerase to…

Q: What is genetic drift?

A: Introduction In this question we will discuss about the genetic drift.

Q: what is a genetic map?   List two areas where genomics can be applied.

A: Introduction A gene is a basic unit of heredity that encodes the production of a gene product, such…

Q: Question 8 Why is replication called semi-conservative? A not all leading strands are conserved B…

A: During DNA duplication, is the method to copy DNA stands when new cells are formed.

Q: what is systematic, phylogenetic tree and phylogeny?

A: Phylogenetics is the observe of the evolutionary history of dwelling beings. Both principles are…

Q: Fig. 7. Graphical representation of Species A and Species B in separate tanks Formulate two…

A: A hypothesis is a proposed explanation for observations made on the phenomenon. It can be the…

Q: .Define autosome, hemizygous, homozygous, and heterozygous?

A: Autosome- All chromosomes, with the exception of the sex chromosomes, are referred to as Autosomes.…

Q: energy flow differently in island pyramids vs landscape pyramids? Is the recycling of matter more…

A: The pyramid of energy depicts the flow of energy from one trophic level to another trophic level. It…