A mutant strain of bacteria is isolated in which the amino acid glutamine is often erroneously substituted for glutamic acid during protein synthesis. What kind of mutation might be underlying this defect? How could you test this hypothesis?
Q: It is conceivable for codons encoding a single amino acid to share the first two bases while…
A: Protein synthesis occurs in all organisms in two main steps: transcription and translation. DNA…
Q: What type of mutation occurred to produce the abnormal sequence (nonsense or missense)? Explain your…
A: A mutation is a change in a DNA sequence.
Q: What causes mutation? Is it always harmful? • Does a simple change on DNA sequence affect the…
A: DNA or deoxyribonucleic acid is the genetic material in living organisms. It is composed of…
Q: What is point mutation.give one example?
A: Mutations are the alterations or the changes that occur in the DNA. Mutagens are the agents that are…
Q: Why might some cells in the body, such as those in bonemarrow, be more susceptible to ribosomal…
A: Mutation It is the sudden heritable changes happening in the genotype of the organism which is…
Q: How is paramutation similar to normal gene mutation? How does it differ? Make a list of similarities…
A:
Q: How does the effect of nonsense mutation differ from that of a frameshift mutation? Why?
A: Mutations are changes that occurs in the deoxyribonucleic acid (DNA) sequence, either due to…
Q: Why does the degenacy of genetic code allow for protection from mutation
A: DNA transfer all the genetic information to RNA through a process known as Transcription later it is…
Q: A mutation occurred that changes the sequence of DNA from: 5’ACGTCATGGATAGTGCGTAAACTA3’ to…
A: Mutations are abrupt changes in DNA only one ways has been changed the original DNA.
Q: Is it possible to have a mutation in nucleotide four that would produce the same amino acid? If yes…
A: A nucleotide is an organic molecule that is the building block of DNA and RNA.They also have…
Q: Which mutation would most likely cause the greatest impact
A: A mutation occurs when the DNA sequence modifies. Mutations can occur as a result of errors in DNA…
Q: How might a single base pair difference about 100 bases before the start codon of a gene cause a…
A: The first codon of the mRNA (messenger ribonucleic acid) translated by the ribosome is called the…
Q: TAT is a codon for the amino acid tyrosine (Tyr). If a mutation changes TAT to TAA, what kind of…
A: The genetic code is a set of rules that is used in the living organisms to translate genetic…
Q: 48. Sickle cell anemia (SCA) is an inherited blood disorder resulting from abnormally shaped…
A: According to the question, we have to mention what type of mutation causes sickle cell anemia among…
Q: It is possible for the codons for a single amino acid to have the first two bases in common and to…
A: mRNAs contain trinucleotide sequences known as codons. The ani-codon site of the tRNA recognizes the…
Q: Some mutations affect changes in protein structure and function that can result in disease whereas…
A: The DNA (deoxyribonucleic acid) is the genetic material of an organism. The DNA is inherited by the…
Q: Which of the following point mutations would properly be defined as a transition mutation? the…
A: The substitution mutations of DNA are of two types: Transitions and Transversions. Transitions are…
Q: Do missense mutations occur in genes encoding tRNA? Why orwhy not?
A: The sudden, stable, inheritable change in the DNA (Deoxyribonucleic acid) is known as the mutation.…
Q: Some substitution mutation result in a malfunctioning protein but others do not. Why is this?
A: Introduction : A mutation is a change that occurs during the copying or replication of DNA…
Q: A nonsense mutation occurs in the AB sequence. What would be the most significant outcome of this?
A: Metabolic pathways- Metabolic pathway is a linked series of chemical reactions occurring within a…
Q: What might be the result of a mutation of DNA in which a triplet code such as UAC now says UAA in…
A: Genetic material is nothing but the sequence of nucleic acids which is called as DNA. It contains…
Q: What type of mutation (missense, silent, and non-sense) was introduced in your sequence when G was…
A:
Q: One reason mutations are so problematic is that bacterial cells have no ability to repair a mutation…
A: Mutation is the process that involves a change in the normal DNA sequence. It can result from…
Q: Why did two different classes of aminoacyl-tRNA synthetases evolving?
A: The translation process is started by ribosomes. Ribosomes are made up of bigger and smaller…
Q: How can you still get a functional protein from frameshift mutation?
A: A mutation is a change in a person's genetic code. Changes as small as the replacement of a single…
Q: You sequence the TBX1 gene from patients to diagnose if they have DiGeorge syndrome, and you find…
A: A chromosomal disorder where a small segment of 22 chromosomes is deleted. It is also an…
Q: Which do you think would be more likely to have an effect on protein function: a silent mutation or…
A: Mutation: - Random process - non-directional - Most of the mutations are harmful. - Mutations are…
Q: Which of the following statements about a transversion mutation in the sequence AGC is true?
A: Transversion alludes to a point mutation in DNA in which a solitary (two rings) purine is changed…
Q: Two types of mutations discussed in this chapter are 1) nucleotide changes and 2) unstable genome…
A: Mutations are sudden heritable changes in the DNA sequence of a gene and are responsible for all the…
Q: Does a mutation always result in a change of an amino acid sequence in protein? Why?
A: A mutation is the alteration of the nucleotide sequence of the genome which may or may not result in…
Q: What is the resulting polypeptide: _______________________________________________________? What…
A: Central dogma is the central processing part in which DNA is converted into m RNA by transcription…
Q: 1) Define the silent mutation in DNA? 2) What is the codon usage bias?
A: Hi! Thanks for the questions. As you have posted multiple questions, I will be answering the first…
Q: TACAT
A: Solution :There are three types of DNA Mutations: base substitutions, deletions and insertions.
Q: Which of the following best describes this type of mutation? Original – CCU-GAU-GAG-UCA…
A: Introduction : Mutations are modifications to the genetic sequence. Mutations can involve the…
Q: make a point mutation and Frameshift mutation
A: point mutation, change within a gene in which one base pair in the DNA sequence is altered. Point…
Q: How is it possible that some, but not all, mutations get passed from one generation to the next?
A: Introduction :- A mutation is a change in the sequence of genetic letters known as bases within a…
Q: What type of mutation is shown below:
A: Structural chromosomal mutations refer to the changes in structure of a chromosome due to insertion,…
Q: If a base was added or deleted and the reading frame shifted, this would be an example of a…
A: Mutation is the change in the sequence of DNA. This may occur due to errors in DNA copying, Ionising…
Q: List three ways in which spontaneous mutations might arise.
A: A mutation is an adjustment in the nucleotide succession of the genome of a life form, infection, or…
Q: Two possible point mutations are the substitution of lysine for leucine or the substitution of…
A: Biological macromolecules are those large molecules that are necessary for the survival and growth…
Q: If most of the DNA in Bacteria and Archaea is coding DNA and much of the DNA in higher plants and…
A: Bacteria have various shapes which ranges from spheres to rods and spirals.Bacteria are among the…
Q: What is a silent mutation? Why is the name “silent mutation” a bit of a misnomer?
A: The flow of information in the cell is generally from DNA to RNA to proteins. DNA contains the…
Q: Silent mutations that occur in DNA are quite common in living cells and usually involve no effects…
A: A gene mutation is a permanent alteration that makes up a gene in the DNA sequence, so that the…
Q: Which of the following mutations involve the loss of one or more nucleotides from a gene sequence?…
A: Mutation is the change or alterations in the nucleotide sequence of genome of an organism. Mutation…
Q: Why did two distinct classes of aminoacyl-tRNA synthetases evolve?
A: Aminoacyl-tRNA synthetases are a class of enzymes that are involved in the process of translation.…
Q: A hypothetical base sequence of an RNA molecule is5′–AUUUGCCCUAGCAAACGUAGCAAACG–3′What topic in…
A: Answer: Introduction: RNA molecule consists of four nucleotide bases these are adenine (A), cytosine…
Q: Which amino acid is at the beginning of every eukaryotic protein and why?
A: The genetic information is transferred from DNA to RNA and from RNA to protein. This flow of genetic…
Q: cause mutation
A: Introduction :- A mutation is a change that occurs in DNA sequence, either due to mistakes when the…
A mutant strain of bacteria is isolated in which the amino acid glutamine is often erroneously substituted for glutamic acid during protein synthesis. What kind of mutation might be underlying this defect? How could you test this hypothesis?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which prevent ions from moving across cell membranes. Normally there are channel proteins that allow passage of the ions, but in patients with one kind of CF these proteins seem odd. Closer examination shows that these proteins display the correct amino acid sequence. However, they fail to do their job. A) Given that the primary structure of the protein is correct, what can you infer about the DNA sequence for the gene coding this protein on this patient, is there a mutation? Explain. B) Why is the primary structure insufficient to guarantee the proper function of the protein?Most of the mutations that Yanofsky recovered were missense mutations. However, Yanofsky also recovered a nonsense mutation that changed amino acid number 15 into a stop codon. This codon normally encodes Lysine. Does the recovery of this mutation support the hypothesis that this Lysine residue is critical in the function of the tryptophan synthetase protein? Why or why not?You are studying the tryptophan synthetase gene that Yanofsky also examined to determine the relationship between the nucleotide sequence and the amino acid sequence of the gene. Yanofsky found a large number of mutations that affected the tryptophan synthetase gene. A) If you took this mutant E. Coli line (that has an Arginine at this location) and exposed it to a mutagen that could potentially change bases, what are the second mutations you would most likely discover that would restore the activity of the tryptophan synthetase gene and where would it be located? B) Most of the mutations that Yanofsky recovered were missense mutations. However, Yanofsky also recovered a nonsense mutation that changed amino acid number 15 into a stop codon. This codon normally encodes Lysine. Does the recovery of this mutation support the hypothesis that this Lysine residue is critical in the function of the tryptophan synthetase protein?
- What type of mutation is shown in the diagram? Why do you think this type of mutation is referred to by this term?Which of the following is a reason why codons are NOT composed of only two nucleotides?Question 22 options: A) It happened by random chance. B) The ribosome is composed of more than 2 subunits. C) The size of tRNAs requires that more than two nucleotides be present in a codon. D) There are 20 amino acids that need to be coded for.A normal polypeptide and a mutant of the polypeptide were hydrolyzed by an endopeptidase under the same conditions. The normal and mutantpolypeptide differ by one amino acid. The fingerprints of the peptides obtained from the two polypeptides are shown below. What kind of amino acid substitution occurred as a result of the mutation? (That is, is the substituted amino acid more or less polar than the original amino acid? Is its pI lower or higher?) (Hint: Photocopy the fingerprints, cut them out, and overlay them.)
- A gene contains the sequence CGCATACGGTAC that results in the amino acid sequence arg-ile-arq- tyr. A mutation in this gene has a G inserted after the second C in the strand. How will this mutation affect the phenotype? A)This will affect the phenotype because although most of the protein will be identical, the first amino acid will be different. B)This will not affect the phenotype because only the second amino acid is different from the original protein. C)This will not affect the phenotype because the protein will be identical to the original protein. D)This will affect the phenotype because all of the amino acids after the first one will be different from the original protein.Two possible point mutations are the substitution of lysine for leucine or the substitution of serine for threonine. Which is likely to be more serious and why?The following nucleotide sequence is found on the template strand of DNA. First, determine the amino acids of the protein encoded by this sequence by using the genetic code provided in Figure 15.10. Then give the altered amino acid sequence of the protein that will be found in the following mutations: Q.Mutant 5: An addition of TGG after nucleotide 6
- As we focused on the genetic code and the transcription of genetic information stored in DNA into complementary RNA molecules. Along the way, we found many opportunities to consider the methods and reasoning by which much of this information was acquired. From the explanations given in the chapter, what answers would you propose to the following fundamental questions: Question: How were the experimentally derived triplet codon assignments verified in studies using bacteriophage MS2?If an extra nucleotide is inserted in the first exon of the beta globin gene, what effect will it have on the amino acid sequence of the globin polypeptides? Will the globin most likely be fully functional, partly functional, or nonfunctional? Why?Neurospora crassa can synthesize the amino acid arginine from a precursor as follows: precursor ornithine citrulline arginine George Beadle and Edward Tatum identified various mutants (arg mutants) unable to synthesize arginine from this precursor. One such class (Class I) could synthesize arginine if either ornithine or citrulline was supplied. A second mutant class (Class II) could synthesize arginine if citrulline was added, but not if ornithine was added. A third class (Class III) could not synthesize arginine from either ornithine or citrulline. Which class or classes of arg mutants will grow on complete media?