A major component of gasoline is octane  C8H18 . When octane is burned in air, it chemically reacts with oxygen gas  O2  to produce carbon dioxide  CO2  and water  H2O . What mass of octane is consumed by the reaction of  9.92g  of oxygen gas? Be sure your answer has the correct number of significant digits.

Q: Please don't provide handwritten solution.

A: Detailed explanation:Understanding the Relationship Between Isomeric Structures in Organic…

Q: A 0.050L solution of Ba(OH)2 is neutralized by 0.072L of a 0.55 M HNO2 solution. What is the…

A: Step 1:Step 2:Step 3:

Q: Classify how each molecule affects the activity of ribonucleotide reductase. Not all of the…

A: Ribonucleotide reductase (RNR) is an essential enzyme that catalyzes the reduction of…

Q: Draw the shape, hybridization and expected-1 angles in the following a- XeО,F b- IF3 c- Br PCl₂ d-…

A: Step 1: Step 2: Step 3: Step 4:

Q: Draw the structure of the product obtained in this reaction and assign all of the proton signals.

A:

Q: CH3 CH₂CCHCH2CH2CH3 CH, C1 CH3 CH3CCHCH2CH2CH3 CH3 Cl H₂O frío Mecanismo: H₂O calor

A: Step 1:Reaction 1: The first reaction occurs at a lower temperature (frio), where simple SN1 type…

Q: The vaporization of methanol CH₃OH(l) ⇌ CH₃OH(g) is an endothermic process in which ∆Hvap = 37.4…

A: Given: ΔHvap​=37.4kJ/mol;ΔSvap​=1111J/mol;P2​=345torr;T2​=???°CP1​=760torr;T1​=Tb​=???Step 1: Write…

Q: Problem 79 of 80 Submit Curved arrows are used to illustrate the flow of electrons. Using the…

A:

Q: Give the IUPAC name for each compound. 1- 1,1- 2- (2E)- 3- 3,3- 4- 5- cis- ene cyclopent- cyclohex-…

A: The IUPAC nomenclature system provides a set of logical rules for naming organic compounds. Here are…

Q: Determine the pH during the titration of 71.2 mL of 0.422 M formic acid (Ka = 1.8×10-4) by 0.422 M…

A: Step 1:a) Before addition of any KOH the pH of the solution is due to ionization of weak acid…

Q: 1. Draw a diagram to show how two ethanol molecules can H-bond with the soap molecule. O ||…

A:

Q: Identify the Michael donor and Michael acceptor that could be used to prepare the following compound…

A: The 1,4-addition (or conjugate addition) of resonance-stabilized carbanions.The Michael Addition is…

Q: The following reaction type is A. Gas evolution B. Single displacement C. Synthesis D. Double…

A: Step 1: MgSO3 + 2HBr ->  MgBr2 + H2O + SO2 Step 2: A. It is a reaction in which there is gas…

Q: Name: Car 5. Determine ASPxn, AH, and AGxn (each in kJ mol¹ to two decimal places) and determine the…

A: Step 1: Step 2: Step 3: Step 4:

Q: 3 ✓ 14 ✓ 15 ✓ 16 ✓ 17 ✓ 18 19 20 21 ✓ 22 ✓ 23 III Review Homework REQUIRED (NOT Pie Progress)…

A: Step 1: We know that, q=mCdT T2​=16.1+273=289.1KT1​=−0.6+273=272.4K =>q=mC(T2​−T1​)…

Q: Draw the structure of the two products.

A: Step 1: Step 2: Step 3: Step 4:

Q: Please don't provide handwritten solution.

A: PThe prompt asks you to:Draw all reasonable elimination products to the right of the arrow.Redraw in…

Q: Chemistry

A: Aldehyde or ketone reacts with one mole of alcohol hemiacetal is formed. With two moles of alcohol,…

Q: Predict the major organic product(s) of the reaction shown below. OH A only B only C only H₂O - ? OH…

A: The major product will be A because addition of -OH takes place according to Markonikov's…

Q: If a 25.0 mL sample of 1.50 M HCL solution were diluted 125-fold, what would be the volume and…

A: Given concentration of HCl (c)= 1.50 MConcentration of new HCl is 125 fold and it is diluted so new…

Q: A nutritional calorie (kcal) is equal to 4.184 kJ. A can of Coca Cola contains 39 g of sugars. We…

A: a. To calculate the energy contained in a can of Coca Cola from the sugars it contains, we first…

Q: If this biomolecule was placed into a buffer at a pH of 5.0 in a charged environment would it move…

A: If the biomolecule is placed into a buffer at a pH of 5.0 in a charged environment, its movement…

Q: Question 3. At 100°C and 16.0 kPa, the mass density of phosphorus vapour is0.6388 kg m-3. What is…

A: Given: T=100.°C;P=16.0kPa;d=0.5388kg/m31kg/m3=1g/dm3=1g/LStep 1: Write the expected molecular…

Q: Draw the major organic product of the following reaction. + PC13

A:

Q: The equilibrium constant for the reaction below is 0.02 mol dm-3 at 298.000 K.Fructose…

A:

Q: Prepare the compound by using suitable reagents. More than one step will likely be required.

A:

Q: None

A: Step 1:Step 2:Explanation:Reaction between Maleic Anhydride and Ethanol - Tetrahedral…

Q: Use synthesis to solve this   Please Write Step by Step Solution  Otherwise i give DISLIKE !!

A: Step 1: Step 2: Step 3: Step 4:

Q: 1-Write the structures of all possible enolates for each ketone. Indicate which you expect to be…

A: Step 1: The enolate with the less substituted C=c double bond is obtained by removing a proton from…

Q: Chemistry

A: Step 1:At first, when no base is added, we have a very low pH because we only have a strong acid.…

Q: 2) Outline a synthesis for each the target molecule shown below given the starting material. Br ZI N…

A: Based on the image you sent, it appears to be a chemistry question about retrosynthesis. The…

Q: Nitrous oxide, N₂O, is a gas used as an anesthetic; it is sometimes called "laughing gas." This…

A: Given: T=33°C2N2​O(g)​⇌2N2(g)​+O2(g)​Kc​=1.3x1034Step 1: Write the formula we need to…

Q: :$;$;);)::$;$$;

A:

Q: 2. Balance the following oxidation-reduction reaction in acidic media. You must use the half-…

A: Given: As(s)​+ClO3(aq)−​→H3​AsO3(aq)​+HClO(aq)​The HCO is really HClO. Step 1: Write the…

Q: draw the mechanism for this reaction 1) Et₂O 2) H₂O MgBr C

A:

Q: None

A: Step 1:KOH is a base and potassium 2-chloropropanoate is the salt, so, in this problem we actually…

Q: Please answer the question for the reaction below: + A) B) D) 1) Base 2) 2-Pentenal 3) acidic water…

A: Detailed explanation:The reaction involves base, propenal, and acidic water. The starting aldehyde…

Q: Question I (from the University of Arizona) Nitric oxide (NO) reacts with H2 to form N2O and H2O. It…

A: Question I: Based on the given rate law, Rate = k[NO]2 [H2], we can conclude that the…

Q: Consider the branched alkane below and complete the following tasks based on its structure. Part: 0…

A:

Q: An arctic weather balloon is filled with 40.3 L of helium gas inside a prep shed. The temperature…

A: Approach to solving the question:Please see attached photos for detailed solutions. Thank you.…

Q: None

A: The question asks for the acid with the strongest conjugate base. This means we're looking for the…

Q: a segment of dna has the following sequences of bases ATGCAATGATATTGAAGCTTA

A: The DNA segment you've provided, "ATGCAATGATATTGAAGCTTA," is composed of nucleotide bases. These…

Q: The question will be based on the reaction below. Cr2+ (aq) + Pb2 (aq)    --> Cr3+ (aq) + Pb (s)…

A:

Q: dont provide handwriting solution ..

A:

Q: How many milliliters of a stock solution of 13.1 M  would be needed to prepare 0.500 L of 0.500 M ?

A: Approach to solving the question: Detailed explanation: Examples: Key references:

Q: Calculate (to the nearest 0.1%) the proportion of a dose of ebastine (pKa of conjugate acid = 10.3)…

A: The Henderson-Hasselbalch equation is expressed as: pH = pKa + log([A-]/[HA]), where [A-] is the…

Q: 1. Draw the possible products from the following reaction. io dioxolane + KOH ?

A: Approach to solving the question: Detailed explanation: Examples: Key references:

Q: 37) How could you accomplish the following synthesis? A) H+/H20; HC=N & B) LIAIH4; HC=N; KMnO4 C)…

A: Step 1. Bromination of ketone.Step 2. Nucleophilic substitution reaction. In case of any doubt…

Q: The preparations of two aqueous solutions are described in the table below. For each solution, write…

A: Step 1:In an aqueous solution, an acid is a compound that produces hydronium ions H3O+ while a base…

Q: QUESTION 1 Combustion of 7.67 g of liquid benzene (C6H6) causes a temperature rise of 47.6 °C in a…

A: Step 1: Calculate the heat absorbed by the calorimeter. qcal = Ccal ΔTwhereCcal = heat capacity of…