9 of 22Comparison of the same gene and its product in two different animal species revealed that the amino acids are 98 percent identical but the nucleotides are only 86 percent identical. What accounts for the much higheramino acid identity than nucleotide identity?O The genetic code is redundant.O The genetic code is ambiguous.The genetic code differs between species.The genetic code is nonredundant.O The researchers sequenced different template strands.

The synthesis of protein is through a process called translation of mRNA, which has been transferred…

Answered: 77 10 Comparison c

Science

Biology

77 10 Comparison c

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter14: Dna Structure And Replication

Section: Chapter Questions

Problem 1TYK: Working on the Amazon River, a biologist isolated DNA from two unknown organisms, P and Q. He...

See similar textbooks

Similar questions

5. The nucleotide sequences of the DNA molecules in the figure below were obtained from four different individuals, one wild type and three mutants. Wild Type 5'-TTATCCATGATCGGATCGATCCATTAGCCGA-3' 3'-AATAGGTACTAGCCTAGCTAGGTAATCGGCT-5’ Mutant I 5'-ATCCATGATCGGATTGATCCATTAGCCGAAT-3’ 3'-TAGGTACTAGCCTAACTAGGTAATCGGCTTA-5’ Mutant II 5'-CCGTTATCCATGATCGGATAGATCCATTAGCC-3’ 3'-GGCAATAGGTACTAGCCTATCTAGGTAATCGG-5’ Mutant III 5'-CACCGTTATCCATGATCGGAACGATCCATTAGC-3’ 3'-CAGGCAATAGGTACTAGCCTTGCTAGGTAATCG-5’ a) Identify the open reading frames in each sequence of DNA and translate them into proteins. Write down the sequence of amino acids that will be obtained after translation: b) Which of the mutations above would be least likely to cause a change in the function of the protein? Why? c) Which of the mutations above would probably cause a major disruption in the function of the protein? Why?
Mapping is the bioinformatics term used to describe alignment of sequence reads to a reference genome. O True O False QUESTION 8 Why would a scientist want to analyze RNA sequence data? (Select all that apply) O To study infections in the blood of individuals. O Determine differences in the expressión of genes between samples O Develop a complete set of genetic differences between samples and O To identify genes that may be important in a disease reference genome
Which of the following statements about DNA is false? a. Phosphate is linked to the 5 and 3 carbons of adjacentdeoxyribose molecules. b. DNA is bidirectional in its synthesis. c. Each side of the helix is antiparallel to the other. d. The binding of adenine to thymine is through three hydrogenbonds. e. Avery identified DNA as the transforming factor in crossesbetween smooth and rough bacteria.
U Introduction to Bioinformatics Midterm AA 18- Protein sequences can be more informative than DNA sequences. Which of the following is NOT one of the reasons? a) Most of the changes in a DNA sequence do not change the amino acid that is specified. b) Protein sequences can provide information on SNPs and differences between individuals that are not translated. sequences. uskudar-sinav-Ims.almscloud.net c) Many amino acids share related biophysical properties and these relationships in an alignment can be used for scoring systems. d) There are 20 characters (amino acids) in a protein sequence whereas DNA has 4 characters (nucleotide bases). e) Protein sequences offer a longer look-back time than DNA Leave blank Close
Are both statements true? 1. Heterogeneous RNA is a term that refers to mRNA that has not been processed. 2. If the %A of a bacteria is 20%, the amount of guanine is 30%. Are both statements true? 1. If the %A of a bacteria is 30%, then the % (G+C) of the bacteria is 40% 2. The DNA is plectonemic because one of the strands go in 5' to 3' direction while the other go in the 3 to 5 direction
EcoRI recognizes GA-A-T-T-C sequence and cleave/ cut between G and A. How will the DNA fragments look like if EcoRI is used for the DNA below? How many fragments are produced? -'3 5'-AAAGATTTGAATTTCGAATTCAATTTAAGAATTCCCTTAGAATTTCC
Part 3. Compare the Specificity of DNA-Cutting Tools The flexibility and specificity of CRISPR-Cas9 technology offer a large step forward for gene editing. The first DNA "scissors" were restriction enzymes, which cut DNA at predefined sequences, typically 4-8 base pairs long. For example, EcoRI, a restriction enzyme found in E. coli, will cut double- stranded DNA at every GAATTC sequence. If EcoRI were added to a sample that contained the entire human genome, it could cut at every GAATTC sequence. We can calculate the probability that a particular nucleotide sequence, such as GAATTC, will occur within a larger sequence. Table 1 below shows the calculated probabilities of finding sequences of particular lengths. These calculations are based on the assumption that DNA sequences are entirely random and that every nucleotide position has an equal probability of being A, T, C, or G. Use the table to answer the following questions. Table 1. Calculated probabilities of finding a specific…
3. After analyzing a DNA sequence for gene properties, the following sequences were reported at the positions provided at the table. Sequence Position (BP) TTGACA 18 TATAAT 42 AGGAGGT 75 ATG 86 UGA 187 TTTTTT 206 i. Identify what regions these positions represent. Provide justification for the identification. 2 ii. Draw an approximate diagram of the gene showing the regions. It is not necessary to draw it up to scale. 1 iii. What kind of organism does the Gene come from? Does the organism have a nucleus? Make an educated guess. 1 iv .Which of these positions would have been present if the organism was of the other type? Identify. 1
EcoRI recognizes G A-A-T-T-C sequence and cleave/ cut between G and A. How will the DNA fragments look like if EcoRI is used for the DNA below? How many fragments are produced? 5- AAAGATTTGAATTTCGAATTCAATTTAAGAATTCCCTTAGAATTTCC -¹3
9. You sequence the genomes of four different organisms and compare their sequences over a short regionas shown below.5′ AGGTATATAATTTGCG 3′5′ CAATATAAAACCCTAC 3′5′ GCGTATAAAAGAGCTA 3′5′ TTATATATAAAGAAGT 3′a. Determine the consensus sequence common to thefour regions above.
Which viruses have potential for the highest mutation rates? Explain RNA viruses as RNA polymerases do not proofread thus make many mistakes/mutations when viral RNA is copied RNA viruses as DNA polymerases do not proofread thus make many mistakes/mutations when viral DNA is copied O DNA viruses as DNA polymerases do not proofread thus make many mistakes/mutations when viral RNA is copied O DNA viruses as DNA polymerases do not proofread thus make many mistakes/mutations when viral DNA is copied
LO 64- Explain how Next gen sequencing is applied in different technologies In which of the following scenario would it be best to use Next-gen sequencing? (select all that apply) a-To separate fragments of DNA based on their size- b-To insert a mutation at random in a gene c-To idently a novel pathogen d-To determine the nucleotide sequence of a microbe e- To insert methyl groups to cytosines in a DNA sequence asap please