6. The following C program cannot be compiled and would not display the correct output. There are four errors in it. Identify which lines contain the error(s), then re-write the correct way to write for each error. 2 3 123456789 B 10 11 12 } // This is a program to calculate the area of a circle #include (stdio.h) main() float radius, area; printf("Radius = ?"); scanf("%f", radius); area = 3.142 radius radius printf('Area = f', area); Error 1 at line - Correct way: Error 2 at line Correct way: - Error 3 at line Correct way: Error 4 at line Correct way:
Q: Draw a simple circuit that implements the following RTL (Register Transfer Language) Instruction:…
A: Step 1: Step 2: Step 3: Step 4:
Q: Until now, the Business College has managed manually the information for rooms and related works…
A: To assist you effectively, I'd break down the tasks you outlined into different steps and provide…
Q: A standard deck of playing cards consists of 52 cards. Each card has a rank and a suit. There are 13…
A: Step 1:Step 2: Step 3: Step 4:
Q: Save the code file again, this time as Q2_OUCU_d.py. In part (c) your code always produces 3…
A: The objective of the question is to modify a Python code so that the number of repetitions of a…
Q: Could you assist me with this question? I'm uncertain about how to tackle this problem, so could you…
A: The objective of the question is to demonstrate that the problem ALL_DFA (which is the problem of…
Q: Develop an Excel dashboard for "Community Health Clinic," analysing patient visits, treatment…
A: To create an Excel dashboard for the Community Health Clinic, we follow these steps:Part 1: Database…
Q: Use a drawing tool, like draw.io to complete the following task: build an extended star network in…
A: Creating an extended star network with both a physical star and a logical bus topology involves…
Q: Draw the logic diagram and the state transition diagram for a sequential circuit with one JK…
A: Step 1: Step 2: Step 3: Step 4:
Q: I need help with parts a and b please
A: The question is asking two things. First, it wants to understand what the provided assembly code…
Q: 3a Draw a flowchart to find the most expensive product / most cheapest product from list ofproduct…
A: To solve the problem of finding the most expensive and the cheapest product from a list of product…
Q: Write pseudocode to find the summation of this sequence:Sum = N/N + (N-1)/2N + (N-2)/3N + (N-3)/4N +…
A: Here's a pseudocode to find the summation of the given sequence:function calculateSum(N, m): sum…
Q: Make own portfolio by maximizing the use of HTML 5, CSS 3, and Javascript, as well as bootstrap…
A: <!DOCTYPE html><html lang="en"><head> <meta charset="UTF-8"> <meta…
Q: assume you have a HashMap class that uses a threshold of 0.75 (75%),regardless of the collision…
A: Separate Chaining:In separate chaining, each array element is a linked list of entries that have the…
Q: A red die and a blue die are thrown. Both dice are loaded (that is, not all sides are equally…
A: step by step solutionStep 1:1) First, let's consider the red die. We know that rolling a 3 is half…
Q: Solve the following queries in SQL. For each query, you need to specify the SQL and show the result…
A: Approach to solving the question:This query uses a combination of filtering and sorting clauses in…
Q: In the packet tracer program, what settings are needed to provide the following network topology
A: ## Detailed explanation of the network topology configuration in Packet Tracer:Components:* **PCs:**…
Q: With the numbers that are given, please make the graph that is also shown in the picture. Please…
A: To create the graph shown in the picture using MATLAB, we need to first define the data points and…
Q: Given the following vertex set and edge set (assume bidirectional edges): V = {1, 2, 3, 4, 5, 6, 7,…
A: In the linked-list based representation of the given graph, each vertex is represented as a node in…
Q: Hey, could you help me out with this problem? I'm having trouble figuring it out and would really…
A: Sure, I can help you with understanding why the problem of determining whether a Turing machine has…
Q: Retrieve information from this webpage…
A: Approach to solvingThis code will print the rank number and the name of the restaurants for the Best…
Q: 4. Think about the idea that you developed in “question 3” to improve your university or…
A: To comprehensively analyze the issues affecting the three kinds of feasibility—technical,…
Q: What is the disadvantages of a single level page table?
A: A single-level page table can have several disadvantages: Memory Consumption:In a single-level page…
Q: Consider the equation x+x+x+x=50. How many different solutions does this equation have if all the…
A: Step 1:
Q: Could you assist me with this issue? I'm finding it challenging to grasp the solution. Would you…
A: The question is asking to demonstrate that the class P of decision problems (problems for which an…
Q: Gamit ang uri ng pagbubuod na SINTESIS, pakibuod ang impormasyon na nakaattach, sigurading huwag…
A: Key references:
Q: Please help me with answering the question
A: To draw the stack of activation records for the given Ada program, we'll represent each activation…
Q: In the calculation of the molecule of H2O, a researcher used the basis set 6-311+G(d,p).(i) Using…
A: EXPLAINED QUESTIONS ASKED IN DETAILED USING 311+G(d,P) and context of split valence basis sets.
Q: solve recursion where t(0) = 0 and t(1) = 4 sqrt 5
A:
Q: Please assist me with these questions. I need help with creating JavaScript code for the flowcharts…
A: For Image 1:function flowchart1(input) { const values = input.split(',').map(Number); let result…
Q: Your team has decided to use Amazon ElastiCache in your application development. Which benefits will…
A: 1. Predictable Performance:Traditional databases store data on disks, which have slower access times…
Q: What are property rights and why do people have a right to property in their own person?
A: ref.Waldron, J. (2012). The Right to Private Property. Oxford University Press.
Q: is code coorect. Is it displaying correct output as described in the flowchart? if not please fix…
A: Step 1: Consolidation into One Function program1() - Since the flowchart does not show the need for…
Q: A system has a CPU utilization of 80%. If the total time is 1000 seconds, calculate the time the CPU…
A: Solution:
Q: What is the most effective paraphrase of the technical document? If you find damage, replace…
A: It effectively conveys the message of the original document by instructing the reader to inspect…
Q: What are some specific harms of privacy in the digital age?
A: Let's analyze it in more detail along with examples. The widespread surveillance and profiling of…
Q: The BufferedReader reads one line of text at a time. If there are several data items in a single…
A: The objective of the question is to identify the correct method of the String class in Java that can…
Q: Could you assist me in understanding this intricate algorithm and guide me through transforming it…
A: Approach to solving the question:Designing a Turing machine for division requires careful planning…
Q: the answer and add explanation properly at every steps and solve steps wise
A: Understanding Flow Control vs. Congestion Control:The smooth flow of data across networks is…
Q: I try to merge the two datasets below using the following code use test score.dta, clear merge 1:1…
A: Step 1: Step 2: Step 3: Hope you understand if you have any query then raise it Please do rate…
Q: Design the pseudocode using arrays for a program. It allows a user to enter 10 numbers, then…
A: The objective of the question is to design a pseudocode that uses arrays to store 10 numbers entered…
Q: Having trouble writing SQL statements on these, guidance would help.
A: 1. ```sql INSERT INTO Departments (DepartmentName) VALUES ('History'); ```2. ```sql INSERT INTO…
Q: 2.7 The "divide and average" method, an old-time method for approximating the square root of any…
A: The objective of the question is to implement the 'divide and average' method for approximating the…
Q: write s simple program to rotate the stepper motor of this lab. In clockwise and anti-clockwise…
A: The objective of the question is to write a program that can control a stepper motor using an…
Q: Find solution to this question on memory hierarchies in computer structures (Refer to the…
A: A.) Block Offset: This is determined by the size of the cache block. Each block in the cache is 64…
Q: Provide the full C++ code for: main.cpp, Human.h, Human.cpp, Elf.h, Elf.cpp, Demon.h, Demon.cpp,…
A: Absolutely, here's an explanation of the provided C++ code for the creature battle program:Structure…
Q: The motion of n planets (Po, P₁,..., Pn-1) is governed by the set of 6n first order ODEs n r₁ =…
A: The text in the image describes the motion of n planets subjected to gravitational forces exerted by…
Q: Until now, the Business College has managed manually the information for rooms and related works…
A: Certainly! Here's a simplified plaintext representation of the proposed UML diagrams based on the…
Q: In this project you will implement a student database using JavaFX. A GUI should be used as the…
A: Create the Student classDefine instance variables for name, major, totalCredits, and…
Q: Solve the following queries in SQL. For each query, you need to specify the SQL and show the result…
A: Query:SELECT ProductFinish, AVG(ProductStandardPrice) AS AvgStandardPriceFROM PRODUCTGROUP BY…
Q: Please add explanation and algorithm please do fast
A: Finding Squares of Numbers from 1 to 10To find the square of each number from 1 to 10. A square of a…
Step by step
Solved in 2 steps
- Write C++ statements to do the following: Declare an array to hold 7 floating values. Assign value 3.3 to the last element in the array. Display the sum of the first two elements. Write a loop that computes the sum of all elements in the array. Write a loop that finds the minimum element in the array.Please rewrite the C++ code below according to the instructions and criteria. Thank you. Instructions Replace as many conditional statements in the 12 Days Of Christmas song with one or more arrays. Criteria compilation - the program compiles without error the first switch statement - replace the first switch statement with an array the second switch statement - replace the second switch statement with an array the if statement - rewrite the inner for loop by replacing the if statement and other statements in the inner for loop with references to these arrays:int last[] {-1, 0, 2, 3, 4, 5, 6, 7, 8, 9,10,11,12};int first[] {-1, 0, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1}; Code #include <iomanip> #include <iostream> #include <string> using namespace std; int main() { for (int day = 1; day <= 12; ++day) { cout << "On the "; switch (day) { case 1: cout << "first";…2. Test Scores File: test_scores.py Write pseudocode for the main() part of a program that asks the user to enter 4 test scores between 0 and 100, then displays a JCU grade for each score and also the average test score. When you have written the pseudocode for main, implement your solution in Python code and test it with a range of meaningful data. Remember that we've done the JCU grades question before, so copy your function from that practical code file. Sample Output Score: 3 Score: 50.5 Score: 66 Score: 100 Score 3.0, which is N Score 50.5, which is P Score 66.0, which is C Score 100.0, which is HD The average score was 54.875 Enhancements When you have that working... We asked for 4 scores. Have a look at your code... did you use 4 as a numeric literal or a constant?Change 4 to 3... Did you have to change the program in more than one place?If so, then you've missed one of the things we've taught...As a strong guideline: if you need to use the same literal more than once, you…
- : Write a program in C++ to input attendance as 0 (for absent) and 1 (for present) for 25 students in 32 lectures and store it in a 2-D array. After the input, write loops for calculating and displaying the index numbers of the students who has short attendance (i.e. less than 75%). Please enter attendance of all 25 students for given lecture (total 32 lectures): Enter attendance of Lecture “1” Student 1: <user enters 0 or 1> Student 2: <user enters 0 or 1> and so on….(Numerical) Using the srand() and rand() C++ library functions, fill an array of 1000 floating-point numbers with random numbers that have been scaled to the range 1 to 100. Then determine and display the number of random numbers having values between 1 and 50 and the number having values greater than 50. What do you expect the output counts to be?(Statistical) In many statistical analysis programs, data values considerably outside the range of the majority of values are simply dropped from consideration. Using this information, write a C++ program that accepts up to 10 floating-point values from a user and determines and displays the average and standard deviation of the input values. All values more than four standard deviations away from the computed average are to be displayed and dropped from any further calculation, and a new average and standard deviation should be computed and displayed.
- When you perform arithmetic operations with operands of different types, such as adding an int and a float, ____________. C# chooses a unifying type for the result you must choose a unifying type for the result you must provide a cast you receive an error messageC++ - No library functions like atoi Write a machine language program to input two one-digit numbers, add them, and output the one-digit sum. Submit your "machine code" followed by a 'zz.'Example: Write a C++ program that calculates the sum and average of an initialized integer array. #include using namespace std;
- C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…Based on the output below, create a C++ program that will include the new and delete operator. Interpret your program; you may include comments in interpreting your own program.SAMPLE OUTPUT: [Enter your own grades]Enter the number of grades to be processed:Enter a grade: 87Enter a grade: 88Enter a grade: 89Enter a grade:90An array was created for 4 integers The values stored in the array are:87888990C PROGRAM Write a program that asks the user values for the coefficient A,B, and C in the quadratic equation Ax^2 + Bx + C= 0, and then prints the solution/s of the equation (if there is/are any) For this problem, you need to include the following header file: math.h So that you can use the C library function sqrt() The function sqrt() computes the square root of a value (in double) Use #include <stdio.h>