54 In the alpha helix shown below, all carbonyl groups are pointing_ amino groups are pointing_ Upwards; Downwards Downwards; Downwards Downwards; Upwards Upwards; Upwards , and
Q: Produces Leaves the nucleus and goes to the... 7. Transcription and Translation---DNA: A A…
A: Piece's of RNA make amino acids, which make proteins and this process occurs in the Cytoplasm. m RNA…
Q: Proteases are one of the main drug targets. Choose the False statement regarding proteases. A.…
A: Proteases are a group of enzymes with a catalytic function to hydrolyze ( a reaction where water…
Q: 3) Histone deacetylases (HDACs) are zinc-dependent enzymes that catalyse the conversion of…
A: Histone deacetylase (HDAC) converts acetyllysine to lysine by removing acetyl group from lysine. The…
Q: 9. 3 μL of a 45 mM stock solution of a substrate is added to 8 mL of water. Calculate the following…
A: The objective of this question is to calculate various parameters related to a solution of a…
Q: If it costs 11.0 kcal/mol to "run" the Na/K ATPase (i.e., pumping 3 Na* ions out of the cell and 2…
A: The mathematical relation between actual free energy change () and biochemical standard free energy…
Q: Calculate the standard free-energy change of the reaction catalyzed by the enzyme…
A: Standard free energy change () is the free energy change at standard conditions.Here;'R' is the…
Q: The data in the table are used to create a calibration curve for the determination of RNA from ts…
A: The 'least square method' is an alternate name for the linear regression model of statistical…
Q: (e) Two ADP agonists (drugs) were also found to bind to platelets: 2-methylthio-ADP bound with a Kp…
A: Binding affinity is the strength of the interaction between a receptor and the ligand.The binding…
Q: Question 2
A: The objective of the question is to understand the function of the metaphase checkpoint in the cell…
Q: Activation energy (a) Draw a general energy diagram for a chemical reaction proceeding from…
A: The enzymes are biological catalysts that increase the rate of biochemical reactions.Most enzymes…
Q: The hydrolysis of sucrose has the following data. Time (min) 0 30 60 90 130 180 [Sucrose] (M) 0.5011…
A: To determine the half-life of the reaction, first identify the order of the reaction. The order of…
Q: Which of the sugars below are diastereomers of compound I? CHO H+ OH H-+OH H+OH CH₂OH I CHO H-OH…
A: Stereoisomers are the type of isomers in which the chemical formula of the molecules as well as the…
Q: You are studying an enzyme in the laboratory that is only active between pH 5 and 8 You wish to…
A: A buffer solution is a water solvent-based solution consisting of mixture of weak acid and its…
Q: Genetics Question 1
A: The objective of the question is to determine which inheritance pattern can be eliminated based on…
Q: Fill in the table below Monomeric units are called: What are unique monomeric units? Linkages…
A: Nucleic acids are biomolecules that are essential for all life forms. They are polymers of…
Q: Question 5 Listen Paul, has hemophilia, a sex linked recessive condition. Which of the following is…
A: The objective of the question is to determine the correct genotype for Paul who has hemophilia, a…
Q: Tumor necrosis factor alpha (TNF-α) is an important cytokine used by immune cells to initiate and…
A: We are given a receptor ligand interaction as shown below.T + R C'T' is the ligand (TNF-), 'R' is…
Q: 4. IPTG is an analog of lactose which is used to release the repressor on the lac operon allowing…
A: It can be defined as any alteration in a particular gene which gives rise to a different expression…
Q: Question 10 Listen Donna is heterozygous for both hemophilia (a sex linked recessive trait) and…
A: The objective of this question is to determine the probability of Donna and Michael's sons…
Q: (5) Muscle and red blood cells produce lactate, which is then transported to the liver to support…
A: When glucose is available, oxygen is present and there is an energy demand; glucose is oxidised into…
Q: 10. Experimental Determination of AG" for ATP Hydrolysis: A direct measurement of the standard…
A: Since conditions inside the cell are different than standard temperature and pressure, biochemists…
Q: look at the molecule form for sucrose why does carbohydrates not follow the one to one carbon…
A: Given that:All carbohydrates not follow the 1:2:1 carbon : hydrogen : oxygen ratio of…
Q: Question4
A: The objective of this question is to determine the genotype of a short-haired cat, given that short…
Q: Question: Estimate the pl of the tripeptide ? Step 1: Determine what can be protonated/deprotonated…
A: There are four classes of biological macromolecules: proteins, nucleic acids, lipids and…
Q: What are the expected results for the reactions: (a) CuSO4 with iron, (b) KMnO4 with ethanol, and…
A: A) CuSO4 with iron This is a displacement reaction. Iron displaces copper and a metallic copper of a…
Q: The peptide PICKHAPPY has what charge state at PH of 0.1
A: There are 4 classes of biological macromolecules: proteins, nucleic acids, lipids and…
Q: What type(s) of non-covalent interaction determine(s) the specificity of base-pairing within a DNA…
A: As per the Watson-Crick model of the DNA double helix:DNA is made up of two strands of…
Q: Why standard samples such as blue dextran/K2Cr2O7 are needed in isolation of alkaline phosphatase?
A: Alkaline phosphatases (ALPs) are a group of isoenzymes situated on the outer layer of the cell…
Q: Problem: From the following information determine the amino acid sequence of a peptide. N-terminal…
A: When a polypeptide undergoes edman degradation it gives PTH derivative of an amino acid residue. The…
Q: 5.. A sample of cells has a total receptor concentration of 25 mM. Ninety percent of the receptors…
A:
Q: a. How many peptide bonds are there? b. How many amino acid residues are there? c. In exact order,…
A: As per Bartelby Guidelines, we can answer only three subparts of a question. So, kindly post other…
Q: 22. For the process, A B, Keq is 0.02 at 37°C. For the process, BC, Keq 1000 at 37°C. A. Determine…
A: The objective of the question is to determine the equilibrium constant for the overall process A…
Q: N - Leucine - Arginine - Proline - Aspartic acid - Methionine - C write the structure classify the…
A: Peptides are composed of amino acids that are bonded to each other via peptide bonds. The ionizable…
Q: An incomplete structure of a porphyrin ring is shown below. The structure is missing three pi bonds…
A: Porphyrin molecules are a popular biological moiety with applications in pharmaceutical chemistry,…
Q: The enzyme aspartate transcarbamoylase (ATCase) catalyzes the reaction below and, as discussed in…
A: The 4 main categories of biochemical reactions are;Neutralization : reactions between an acid and…
Q: 31.A) What is the overall order of an enzymatic reaction, under conditions where the substrate…
A: Km is the Michaelis menton constant which is equal to Substrate concentration at which the velocity…
Q: Use the name of the enzyme and any coenzyme to predict the products of this reaction. OH…
A: Enzymes that are termed 'dehydrogenase' catalyze the oxidation of their substrate with concomitant…
Q: The Michaelis-Menten equation models the hyperbolic relationship between [S] and the initial…
A: Those proteins or biological catalysts which help to speed up the chemical reaction are termed…
Q: Why is it that the carboxylate "ions" actually partake in the citric acid cycle ratherthan the…
A: The regeneration of oxaloacetate from citrate is called the citric acid cycle. It occurs in the…
Q: Genetics Question 5
A: The question is asking us to determine the probability of a mouse offspring having a straight tail…
Q: 5. Draw an approximate titration curve of glycine. Label the approximate isoelectric point of the…
A:
Q: Mitchell presented theoretical calculations to show how a reversible ATPase system located in a…
A: In an anisotropic reversible ATPase system ATP hydrolysis is not consistent or equal in all…
Q: 5. Explain the difference between a centriole and a centromere
A: The objective of this question is to understand the difference between two key components of a cell:…
Q: Genetics Q2
A: The objective of this question is to determine the probability of Cindy's children inheriting…
Q: Use excel to plot the following titration data. Once you have done your plot, make sure to label the…
A: pH = If [H+] concentration in a solution is high, the pH will be low and the solution will be…
Q: Draw a mechanism to account for the inter-strand cross linkage of two guanines by busulfan. Explain…
A: Busulfan is a drug used to treat cancer. It can form inter-strand crosslinks between guanine species…
Q: 1- Pain is one of the cardinal sign of inflammation, Give the mechanism behind 1 development of this…
A: The main cause of pain during inflammation is the production of chemical mediators such as…
Q: . The structure of certain porin proteins is organized into an interesting beta-barrel, in which…
A: IntroductionStructureAquaporin have structure consisting of 6 member helical structure forming…
Q: Draw the structure of the tri-peptide Leu-Asn-Ser at pH 7.4. Use wedges and dashes around the…
A:
Q: Genetics Question 7
A: The objective of the question is to determine the genetic characteristics of the polydactyl trait in…
Step by step
Solved in 3 steps
- Which amino acid sequence will form part of which protein structure, and why? Sequence 1: Ser-Phe-Gln-Val-Lys-Leu-His-Tyr-Asp-Val Sequence 2: Glu-Tyr-Leu-Asn-Phe-Ala-Gln-Val-Leu-Arg __Amphipathic beta strand __ Amphipathic alpha helix4. A polypeptide comprised of 17 amino acid res- idues with the sequence on the right is ob-served by spectroscopic methods to undergo transitions from an a-helix conformation to a B-sheet as a function of pH and concentration. The acetyl and carboxamide groups are attached covalently to deri- vatize the N- and C-terminal residues, respectively, to avoid charge effects of the end groups. CH3CO-ΤAΤΚΑE LLAKYEATΗK-CONH2 (a) ( amino acid residues. Write the sequence of this polypeptide with corresponding 3-letter abbreviations for the (b) At pH < 4 the polypeptide forms an a-helix. (i) ( the helix? and (ii) (: · with respect to the positive and negative ends of the macrodipole? ) What is the direction of the macrodipole of | Are the charges on the N- and C-terminal residues stabilizing or de-stabilizing (c) (* stabilize the helical conformation. What are the most likely protonation states of the side-chains that provide a-helix stabilizing interactions? Use the helical wheel (at the back…nt #2 nt #3 nt #4 3. In the following sequence, which of these nucleotides a. would have a free triphosphate group extending from one of the carbons of their sugars? b. would have a free hydroxyl (OH) group extending from the carbon of their sugars? nt #1 5'-GCAT-3' 3'-CGTA-5' nt #8 nt #5 nt #7 nt #6
- 4. A polypeptide comprised of 17 amino acid res- idues with the sequence on the right is ob-served by spectroscopic methods to undergo transitions from an a-helix conformation to a B-sheet as a function of pH and concentration. The acetyl and carboxamide groups are attached covalently to deri- vatize the N- and C-terminal residues, respectively, to avoid charge effects of the end groups. CH3CO-ETATKAELLAKYEATHK-CONH2 (а) amino acid residues. Write the sequence of this polypeptide with corresponding 3-letter abbreviations for the (b) At pH < 4 the polypeptide forms an a-helix. (i) the helix? and (ii) with respect to the positive and negative ends of the macrodipole? What is the direction of the macrodipole of Are the charges on the N- and C-terminal residues stabilizing or de-stabilizingNH но- `NH2 ÓH ÓH Он ОН Which nucleotide is shown in the picture above? deoxyguanosine triphosphate guanosine triphosphateUsing Figures 8.7 and 8.9 as a guide, draw a dinucleotide composed of C and A. Next to this, draw the complementary dinucleotide in an antiparallel fashion. Connect the dinucleotides with the appropriate hydrogen bonds. FIGURE 8.9 The two polynucleotide chains in DNA run in opposite directions. The left strand runs 5 to 3, and the right strand runs 3 to 5. The base sequences in each strand are complementary. An A in one strand pairs with a T in the other strand, and a C in one strand is paired with a G in the opposite strand. FIGURE 8.7 Nucleotides can be joined together to form chains caled polynucleotides. Polynucleotides are polar molecules with a 5 end (at the phosphate group) and a 3 end (at the sugar group). An RNA polynucleotide is shown at the left, and a DNA polynucleotide is shown at the right.
- 6) Proline is not commonly found in the middle of a-helices because its ring structure prevents it from adopting the proper value and because it disrupts the hydrogen-bonding pattern of the helix. Looking at the structure of proline in the amino acid sequence below, suggest how this residue would disrupt the hydrogen-bonding pattern of an a-helix. 'N H R N N H *** R5 of 28 STRUCTURE OF DNA Scientists have determined that the main function of DNA is to contain the instructions for making These compounds are responsible for your genetic makeup. O starches O carbohydrates proteins O lipids 1 2 | 3 4 6 8 10 mOne common secondary structure found in proteins in the a-helix. On the diagram below is an a- helical region of the enzyme lysozyme. The sequence of this region is: NH Arg - Cys - Glu - Leu - Ala-Ala-Ala-Met-Lys. COO- 0 0 on the top 0 on the bottom R Is the N-terminus on the top or on the bottom of this diagram? R
- In hinge region, what is the most prominent amino acid existing? A B C D E proline G F困 STRUCTURE AND NOMENCLATURE Name the fourth nucleotide from the 3' to 5' end. Use the How many terminal phosphate/s is/are present in the given structure? Give correct/appropriate punctuations, spacing and letter case based on the nomenclature. ONLY the NUMBER of the terminal phosphate/s. NH, O P-0 OP-O- OH 0=-0- NH: NH: NH; NH. 0=P-0- OH 0P-0- 0P-0- 0=P-0- OH 9:53 am P Type here to search 4) ENG 13/10/2021 近Translate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3 O met-ala-phe-lys-stop O met-ala-phe-lys- met-tyr-his-gly-val-stop-met-gly O met-ala-ser-gly-thr-stop O tyr-his gly-val-stop-met-ly O ala-phe-lys stop