Q: MOLECULAR CLONING • Molecular cloning is the laboratory process used to create recombinant DNA. • It...
A: Recombinant DNA: it is a method of combining two distinct DNA (molecule) sequences, which may or may...
Q: Cotegory: Inflammation Mechanism of vascular permeability includes all of the following EXCEPT:
A: Endothelial contraction renders spaces between adjacent endothelial cells and hence increases permea...
Q: For each genotype listed, what allele combinationswill occur in gametes?a. AABBCC c. AaBBCcb. AaBBcc...
A: Gregor Johann Mendel is usually defined as the way that they are been regarded as the father of gene...
Q: 3. Cross a man with type B heterozygous blood with a woman with type O blood. What are the possible ...
A: ABO blood group is an example of multiple allelism. Co dominance are also seen in blood types when b...
Q: What is myocardial infarction (a heart attack)?
A: A muscular organ in most animals that pumps blood through the blood vessels of the circulatory syste...
Q: Human somatic cells have 46 chromosomes. Are the cells different in any way from the parent cell and...
A:
Q: _1. It is the important organ that controls thought, memory, emotion, touch, motor skills, vision, b...
A:
Q: Black body (b) and purple eye (pr) are recessive autosomal mutations in Drosophila. Bridges are cros...
A: b - allele for black body - recessive pr - allele for purple eye - recessive B - wild type for body ...
Q: Test 6- Comparing the DNA (Gene) Code for Dopamine Active Transport Protein Once dopamine triggers a...
A: Here, human DATP gene sequence of human is given , i.e : ATTCCGGATCGATATCGCCGGATATACTCCGGTAATATC
Q: If you could replace all of the plant ATP synthase with ATP synthase enzymes from animal cells, orie...
A: Chemiosmotic hypothesis explains the mechanism by which ATP is synthesized by the ATP synthase compl...
Q: B: Lambda DNA/Hindlll Marker, 2 GeneRuler" 1 kb DNA Ladder O'GeneRuler" 1 kb DNA Ladder, ready-to-us...
A:
Q: When comparing evolutionary similarities between different genes within a gene family, it is usually...
A: Genes are the basic units of inheritance in living organisms. They are passed down from parents to t...
Q: Q:-What is neoplasia?
A: Introduction In this question we will discuss about the Neoplasia.
Q: QUESTION 4 Which of the following antibody specificities would be a likely hypothesis based on the r...
A: Antibody detection test :- This test is used to detect antibodies.
Q: Explain in your own words: What are the unique anatomical structures observed in birds to carry out ...
A: Introduction:- Avian gastronomy is as diverse as that of mammals, resulting in classifications such ...
Q: 5. Why do you think you feel tired and lethargic when you have a high fever?
A: Humans have evolved to develop body's responses and especially immune responses in such a way that k...
Q: (a) What is resource partitioning? (b) Fully describe an excellent example of resource partitioning.
A: A community consists of a population of different species.
Q: Compare the functions of statocytst, semicircular canals, uticle and saccule
A:
Q: How does an enveloped virus like Coronavirus, enter the host's cell? What is the difference between ...
A: Virus: it is usually nucleo-protein particles i.e. nucleic acid surrounded by protein capsids.
Q: What is an aliquot? Give two uses of serial dilution.
A: Introduction: Serial dilution is a series of repeated dilution performed on the same solution to cha...
Q: In humans, PKU (phenylketonuria) is a recessive disease caused by an enzyme inefficiency at step A i...
A: A recessive disease requires two copies of the abnormal allele to manifest, that is, individuals sho...
Q: Explain in your own words: How and why are avian and human muscles different?
A: There are three types of muscles in the human body: skeletal, cardiac, and smooth. Skeletal muscles ...
Q: Explain the terms "methylase," "methylates" and "methylation"
A: METHYLASE:- A methylase is the enzyme that recognizes a specific sequence and methylates one of the ...
Q: In your own understanding, Indentify the hurdles that may help to lengthen the shelf-life of squash ...
A: The shelf- life of a product depends upon the condition in which the product is being placed. Better...
Q: Mendel crossed a true-breeding pea plant with green pods and a true-breeding pea plant with yellow p...
A: Gregor Johann Mendel is usually defined as the way that they are been regarded as the father of gene...
Q: We observed that a hungry herbivorous animal has eaten the bark of a small tree to as far as it can ...
A: Herbivores are animals whose primary food source is plant-based for example – deer, koalas, and so...
Q: . In an interrupted-conjugation experiment in E. coli, thepro gene enters after the thi gene. A pro+...
A: Part A. The genotypes of the two types of cultures are: pro+ thi- They grow only on the media that...
Q: Why are the elements found in the I=P x A x T important in terms of them having an impact to our env...
A: Any organism cannot survive in isolation. It is surrounded by a number of biotic and abiotic factors...
Q: 2. In horses, black coat color is influenced by the dominant allele (B) and chestnut coat color is i...
A: The recessive characteristic will only be displayed in offspring with two copies of the recessive ge...
Q: In your own words, kindly give the function and allowable limit (if applicable) of each of the follo...
A: All the given ingredients have their own health benefits. These ingredients are essential and have a...
Q: Two adaptations of the monarch butterfly that aid in its survival are the production of a certain ch...
A: Option c- mimicry is correct option . Different animal of different species live their lives in a wa...
Q: What are the main types of waste?
A: Answer : there are mainly four types of waste which are desposed by many people around the world. T...
Q: 1. A woman will give birth to a twin without knowing the gender. What is the probability of having t...
A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: Twi...
Q: What are the four general kinds of adult tissues in animals? What are their general functions? What ...
A: Tissue constitute a group of cells, arranged in an orderly manner that communicates together and all...
Q: Where do spindle fibers attach on a chromosome? O cell plate O meristem centromere
A: The chromosomes can be described as the thread like structures that can be found in the nucleus of t...
Q: Which technique/s is/are used in DNA probe development? O CRISPR O ONA profiling OPOR O DNA recombin...
A: PCR Species-specific probes have been developed. For example, specific DNA fragments specific to A....
Q: Using appropriate examples, explain and diagram the autosomaldominant and autosomal recessive inheri...
A: The inheritance of a particular gene (either dominant or/and recessive) can be identified by pedigre...
Q: Mycobacteria tuberculosis and Rickettsia
A: Mycobacterium tuberculosis is a pathogenic that bacteria from the family Mycobacteriaceae and the ca...
Q: During the Paleozoic, many life forms developed hard parts (shells/bones/etc.). Why would it be use...
A: Shelled animals, the majority of which are sea-based, come in a wide range of shapes and sizes. Beac...
Q: Meiosis produces daughter cells that are mitosis produces daughter cells that are diploid / diploid ...
A: Introduction : Meiosis - it's a cell division process occurs in germ cells. In meiosis from a dip...
Q: Which one of the following describes an epigenetic modification? O A point mutation in the coding se...
A: A methyl group bound to DNA inhibit transcription of gene. This sentence denotes an epigenetic modi...
Q: Define single nucleotide polymorphism (SNP), restriction enzyme, cathode, anode, agarose, well, and ...
A: All these are components are used in gel electrophoresis Gel electrophoresis is a technique in whic...
Q: Gel electrophoresis separates molecules based on size O charge O weight What is the restriction cut ...
A: Gel electrophoresis is a technique by means of which the DNA molecules are separated on the basis of...
Q: What are pioneer species? What is the role of pioneer species?
A: What are pioneer species? Hardy species that are the first to inhabit previously biodiverse steady-s...
Q: find an example of a set of genes that have been horizontally gene transferred between bacteria or a...
A: Horizontal gene transfer (HGT) can be defined as the acquisition of genetic material from another or...
Q: Most of the feathers of erminette fowl are light colored, with an occasional black one, giving a fle...
A: Gregor Johann Mendel is usually defined as the way that they are been regarded as the father of gene...
Q: Feral cats in Australia I read they are insaive species causing harm to wild life? What harm can the...
A: Feral cats are mainly untamed and unowned cats that mostly live in the wild and avoid socialization....
Q: Do these phylogenies depict the same relationships among taxa? Explain yes nd why. * А C B A CB
A: The polyphyletic taxon consists of a group of organisms that share similar characteristics but do no...
Q: The following DNA sequence has been identified and named ‘Gene Z’. It is thought that this sequence ...
A: PCR is a polymerase chain reaction, this is a biotechnological process which is used to amplify the ...
Q: How does methylation affect development in terms of epigenetics, cancer, and general development?
A: Answer :- Cancer cells contain adjusted DNA methylation designs. There is a lot of lessDNA methylati...
5
Step by step
Solved in 2 steps
- IOR HI Table 4: Transgenic Organisms and How They Benefit Human Society Transgenic Organism Field How the Organism Benefits Human Society (Limit your explanation to 2 or 3 sentences.) Because of these transgenic E. coli, human insulin can now be obtained without using human pancreas from cadavers. This also made possible the production of large amounts of human insulin over a short period of time. Allergic reactions from insulin injections are also prevented. Stud Medicine Human insulin- producing E. coli Medicine Agriculture BioremediationTable 4: Transgenic Organisms and How They Benefit Human Society Transgenie Organism Field How the Organism Benefits Human Society (Limit your explanation to 2 or 3 sentences.) Because of these transgenie E. coll, human insulin can now be obtained without using human pancreas from cadavers. This also made possible the production of large amounts of human Insulin over a short perlod of time. Allergic reactions from Insulin injections are also prevented. Human insulin- producing E. coli Medicine Medicine Agriculture Bioremediation CoreGive a schematic diagram of how we can Treatment Thalassemia by using gene therapy? Please answer at your own words,please..
- I understand that microarrays are being used to define the molecular abnormality and the prognosis in some patients with leukaemia. What are microarrays?Differentiate between pro-insulin and mature insulin. Name the commonly used vector for cloning genes into higher organisms.Identify the type of genetic modification being presented in each item. 1. Production of pest-resistant plants 2. increase of milk production per cow 3. increase microbe-dependent-food production 4. increased human immunity to microbe-caused-diseases 5. double production of eggs in chickens 6. increase of crop production
- Which of the following statements is true of Bt corn? It is not common in the United States. Bacterial genes were introduced into the plant with a tumor inducing plasmid (Ti) It expresses a toxin that can make you sick It contains an Agrobacterium that kills insect pests It expresses a Bacterial toxin that kills insect pests It is a transgenic plantA 6-year-old girl with chronic anemia requiring repeated blood transfusions is undergoing genetic testing. The patient's mother and older sibling have a history of mild anemia. Her peripheral blood smear shows hypochromic, microcytic red blood cells, and sickle cells. Doctor has expressed opinion to use electrophoresis for diagnosis. Please explain how may it work for this disease?Below are some of the arguments about the use of transgenic organisms. From your own perspective, explain your answer in the questions in not more than 5 sentences. 1. If you are a farmer would you take the chance of growing crops that are pest resistant? Why or why not? 2. Considering the knowledge gained in genetic engineering, would you try to patronize GMO fruits and vegetables? Why or why not? 3. Is creating or altering genes of an organism a form of Blasphemy to the creator (God)? Why? 4. Is genetic engineering morally permissible or not?
- Nicotinamide Adenine Dinucleotide (NAD) Assay (SIGMA Kit MAK037) analysis of tissue samples initially requires: centrifugation at 13,000g for 10min to homogenise tissue. centrifugation of 20mg of tissue at 2,000rpm with Extraction Buffer. freezing and thawing for 2 cycles of 20min before addition of Extraction Buffer. homogenization of PBS washed tissue with Extraction Buffer.STR markers: are point mutations detectable by DNA sequencing are variations in the number of repeats of very short DNA motifs (2-10 nucleotides) □have high polymorphism are mutations leading to proteins or blood groups that can be differentiated by antigenic testing from a blood sample ☐have low polymorphism no correct answer are changes of a few nucleotides leading to the absence or presence of a site recognized by a restriction enzyme are variations in the number of repeats of medium-sized DNA motifs (10-100 nucleotides) can be located in coding sequences are located exclusively on autosomesBacteria are the most common GMOs because their simple structure permits easy manipulation of their DNA. This manipulation or genetic modification can be completed by series of steps and processes. Using the diagram below, explain the process of how a transgenic bacterium is used in producing large quantity of genetically-engineered insulin for humans which has helped a lot of diabetic patients.