4. Assume no crossing over between homologous chromosomes, what is the probability that two randomly selected sperm cells (male gametes) will get the same paternal chromosome 11 (chromosome 11 is an autosome)? Explain your reasoning. beicool
Q: 1. Your class has been studying cell division in a number of organisms with different chromosome…
A: In the given picture, we are given with 12 slides each represent a particular stage of cell…
Q: 5. Is the epigenetic regulation of DNA exclusive to the X chromosome? Defend your answer (if yes,…
A: Epigenetic mechanisms :- it control access to the chromosomal region to allow genes to be turned on…
Q: 16. Genetic Variation can occur when homologous chromosomes cross over. What occurs during this…
A: Chromosomes comprise long DNA molecules of the organism. Each chromosome consists of two chromatids…
Q: 19. Independent assortment of chromosomes is a result of which of the following processes? A) the…
A: As per Bartleby Guidelines experts are allowed to answer only 3 sub parts kindly post the other…
Q: 2. In the cells below, draw the two possible arrangements of Abdul's sex chromosomes and the…
A: The meiosis is the cell division process by which a diploid (2n) cell divides it's nucleus twice and…
Q: 12. The unlettered circle at the top of the accompanying figure shows a diploid nucleus with four…
A: Mitosis and meiosis are the two kinds of cell division. When people say "cell division," they…
Q: 7. Which term best describes two chromosomes that have the same types of genes in the same…
A: Genes are the units of heredity that are transmitted through generations. Genes contain the genetic…
Q: 4. Characterize the following human chromosomes as to size and as to position of its centromere.…
A: human chromosome consist of 22 autosomes and 1 sex chromosome.
Q: 2. Using the same set of chromosomes (& the same color), illustrate meiosis. Allow crossing over to…
A: Mitosis is cell duplication
Q: 2. Compare any differences in the appearance of genes on chromosomes in gamete cells when crossing…
A: Crossing over : It is essential for the segregation of chromosomes during meiosis . It also accounts…
Q: 2. In the human life cycle, meiosis occurs during the production of 3. In the plant life cycle, the…
A: A diploid organism is an organism that consists of two complete sets of chromosomes (2n) in the…
Q: Cici3C4 CO it u 3. Could alternate arrangements of chromosomes occur during Metaphase I? What is…
A: The indirect process of cell division in which the chromosomes of parent cells divide once but…
Q: 2. Using a particular family as a model, how do you distinguish nuclear from extrachromosomal…
A: Nuclear genomes are inherited equally from both parents. mtDNA is inherited from mother only. With…
Q: One distinct trait exhibited by individuals with the condition in TURNER SYNDROME 2.Aneuploidy is…
A: Note: As Per Guidelines, We Can Answer One Question At A Time. Ask Again To get rest answers.…
Q: 1. How many sperms will be formed from 16 secondary spermatocytes? __2. If an organism’s somatic…
A: Gametogenesis is a process through which male and female gametes (sperms and eggs) are formed in the…
Q: 3. There are 40 chromosomes in somatic cells of the house mouse. (a) How many chromosomes does a…
A: As Per Bartleby Guidelines, only first 3 parts of a question are answered. For further answers…
Q: 4. A cell contains 1 pair of chromosomes. One chromosome contains the R, E, and L alleles. The other…
A: Meiosis.
Q: 25. Crossing over involves each of the following with the EXCEPTION of O A. Transfer of DNA segments…
A: Crossing over is defined as the exchange of genetic material between two homologous chromosomes. It…
Q: 3. There are 40 chromosomes in somatic cells of the house mouse. (a) How many chromosomes does a…
A: The mouse has two sets of chromosomes, making it a diploid creature. Each mouse somatic cell has 40…
Q: 3. What are other types of chromosomal aberrations? List examples for each type.
A: Chromosome is a compact structure of a DNA molecule wrapped around some proteins. It is generally…
Q: Why are organisms that have only a single set of chromosomes (haploid) often more favorable for…
A: NOTE-"As per our honor code, we are authorized to answer only one question at a moment. As you have…
Q: 2. Compare any differences in the appearance of genes on chromosomes in gamete cells when crossing…
A: There are two types of cell division i.e mitosis and meiosis.
Q: 4. How many sex chromosomes in a normal human karyotype? 5. What are the sex chromosomes in a male,…
A: Chromosomes are the thread-like structures present inside the nucleus of the cell. It is made up of…
Q: 7. Which sequence represents the correct order of events for the formation and development embryo?…
A: Reproduction is the process which is responsible for producing the young ones.
Q: 8 Why X-chromosome aneuploidy can cause sterility
A: Chromosomes are long thread-like structures that carry coded genetic information in the form of DNA.…
Q: 5. By conducting testcrosses, researchers have determined that corn has ten linkage groups. How many…
A: To determine the genotype, the experiments are done in which organism of dominant phenotype is…
Q: 9. During prophase I of meiosis, these pairs form a tetrad in a process called a) When homologous…
A: Answer. Answer 9. During prophase I of meiosis, these pairs form a tetrad in a process called…
Q: 2 In mammals, males have two different sex chromosomes (X and Y) and females have two similar sex…
A: Sex of an individual human or birds is determined by the presence of specific chromosomes. Usually…
Q: 5 points A woman is phenotypically female but has a Y chromosome. Further tests find a deletion in…
A: People usually have X and Y as sex chromosome. Women have two X chromosome while boys have one X…
Q: 7. With half the SEX CHROMOSOME (two letters) from each parent, what does the sex chromosome of the…
A: Columbidae could be a bird family consisting of pigeons and doves. it's the sole family within the…
Q: How do humans maintain the normal number of chromosomes across generations?
A: A chromosome is a genetic material which is made from the DNA molecule. Generally, humans have 46…
Q: 3. Diploid somatic cells of elephants have 56 chromosomes. What would be the resulting number of…
A: Primary spermatocyte undergoes meiosis to produce spermatids. Meiosis occurs in two stages,…
Q: 2. The amount of DNA in a Drosophila melanogaster somatic cell equals 8 during G1 of interphase, how…
A: According to the rule, the amount of DNA or chromosomes is the number of chromatids present.
Q: 1) What is Dosage compensation as it relates to sex chromosomes
A: As we know, human females are homogametic with chromosomal constitution 44A+XX and males are…
Q: 3. Because of recombination, sexual reproduction produces more variation than asexual does. Why is…
A: Because of recombination , sexual reproduction produces more variation than asexual does. variations…
Q: 17. A somatic cell in a human male contains No genes on the sex chromosome Genes on only on sex…
A: Somatic cells are those cells which are found in the body other than sex cells.
Q: 7. Domestic house cats have a diploid chromosome number of 38. How many chromosomes would you expect…
A: Domestic cats have 38 chromosomes. The chromosome number generally refers to the number of…
Q: 1. Read the information in the first three slides until the description of the APP protein. ļa.…
A: Genetic material is nothing but the sequence of nucleic acids which is called as DNA. It contains…
Q: 12. How do cells generate genetic diversity? Basically, through either mutation or genetic…
A: Genetic recombination is a process by which organisms acquire genetic diversity. The exchange of…
Q: 22. Dogs have diploid number of 78 chromosomes. How many chromosomes do their gametes have? O A. 39…
A: Chromosomes are thread like structure found in the nucleus of both plant and animal cells.…
Q: 1. Your class has been studying cell division in a number of organisms with different chromosome…
A: Chromosome: It is a strand of DNA encoded with genes that are found inside the nucleus. The termed…
Q: 3. If a gamete of a FISH-X has 32 chromosomes, how many of each of the following structures will be…
A: “Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…
Q: 2. Why is meiosis in human females described as asymmetric?
A: Hi, as per our guidelines, we will answer one question at this time. We kindly request you to post…
Q: 17- Klinefelter syndrome in humans, which leads to underdeveloped testes and sterility, is caused by…
A: Klinefelter syndrome is seen in boys and men. These individuals have one extra copy of the X…
Q: 27. Which of the following is not part of meiosis-1 A Prophase-1 B. pro…
A: Introduction Meiosis is a process in which a single cell divides twice to produce four cells with…
Q: 4. Down syndrome, a nondisjunction disorder associated with mental disability, occurs when a person…
A: Down syndrome, also called trisomy 21 is a genetic disorder caused by the presence of all or part of…
Q: 7) Why aren't Turners females who have one X chromosome phenotypically normal given that males only…
A: “Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: 16. The diagram below shows a phase in meiotic cell division. In which phase does this process…
A: INTRODUCTION Meiosis In this division the chromosome number will reduce to half in daughter cell.…
Step by step
Solved in 2 steps
- A amp PBR322 4301 fot B Clear Zones Figure 2 The postgraduate student, Demika, inserted her gene of interest into the plasmid, pBR322, before transformation into the competent host cell using heat shock method. After that she cultured the cells on the Ampicillin agar plate before replica plating the colonies onto another Ampicillin (A) and Tetracycline (B) agar plates shown in Figure 2. (1) Referring to the vector pBR322 in Figure 2, which recognition site was cleaved to insert the gene of interest? Based on the observation above, can you identify which colonies are carrying positive mcombinants of BR322? Explain your selection.Kha Vu Danels Include: 8DX : Safehy Jor bromie tnto lab repart! Name Section date sheet MAPPING PRACTICE #1 Below is a restriction map for the plasmid PGEN 101 (total length = 20 Kb). Using this map as a guide, give the number of restriction fraqments along with their associated lengths that would result from digesting PGEN 101 with the restriction enzymes EcoRI, BamHI and a combination of ECORI and BamHI. BamHI 3.2 Kb 1.7 Kb EcoRI BamHI PGEN 101 8.7 Kb 5.5 Kb .9 Kb EcoRI ECORI DIGESTION PERFORMED SIZES OF FRAGMENTS OBTAINED 10.4 kb , 0.9kb, 8.7 Kb EcoRI 3.2 Kb, 16. 8kb BamHI EcoRI + BamHIGel electrophoresis separates molecules based on size O charge O weight What is the restriction cut site for HaellR ATAT GGCC O AATTAA O CGGGC
- HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. How did the researchers know that the radioisotopes in the fluid came from outside of the bacterial cells and not from bacteria that had been broken apart by whirling in the blender?HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. After 4 minutes in the blender, what percentage of each isotope was extracellular?Which of the following can be used to carry foreign DNA into host cells? Choose all correct answers. a. RNA b. viruses c. PCR d. plasmids e. lipid clusters f. blasts of pellets g. xenotransplantation h. nanoparticles
- HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. The extracellular concentration of which isotope increased the most with blending?HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. Before blending what percentage of each isotope. 35S and 32P, was extracellular (outside the bacteria)?HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. Do these results imply that viruses inject DNA or protein into bacteria? Why or why not?
- AsapSynthetic polylinker Hindill EcoRI sticky end 5 AATTCCTGCAGAAGCTTCCGGATCCCCGGG CITAA Plasmid cloning vector (cleaved with Eco) GGACGTCTTCGAAG GCC TAGGGG CCCTTAA AATTC Psti Hindi Nelson & Co, Leninger Principles of Biochemistryde ©2021 WH Freeman & Company BamHI Smal EcoRI sticky end Enzyme Polylinker transferase; 2 ligase; 6 lyase; 6 lyase; 4 ligase; 4 BamHi Smal CITAAG GRATT C EcoRI Which pairing correctly matches the enzyme class and Enzyme Commission number for the enzyme that catalyzes this reaction?ING SYSTEM (ACADEMIC) estion The use of PCR OLA assay is important for the detection of O a. Flu viruses et ered Ob. HIV infection ed out of Oc. Cystic fibrosis O d. Unknown genetic diseases ag ion O e. Malaria estion Genetic instability in cancers is mainly caused by the following except O a. Microsatellite instability et red O b. Chronic DNA damage d out of O c. Gåining of tumor suppressor genes O d. Deactivation of mismatch repair genes on O e. Gaining of oncogenes stion The most common bacteria species used for the production of indigo dye is Answer: ed d out of stion In the method to prepare the live Cholera vaccine, the truncated A1 peptide was integrated into the ch Cholera strain by? 00 HUAWEI ova 2 Plus DUAL CAMERA ed