3. What is the major organic product obtained from the following reaction? CH3 S CH COCI AIC b COCH3 OCH3 CH3 COCH3 2 3 CH3 .COCH3
Q: A = double cutter (1000 bp, 800 bp) - 800 is being cut by the single cutter because 600 + 200 = 800,…
A: To identify which enzyme is the single cutter and which is the double cutter based on the…
Q: a)Dr. Thisisaneasyexam decides to amplify a gene from a plasmid using PCR. She starts out with 6.6 x…
A: Sure, let me provide a more detailed explanation for the calculations.a) Calculating the number of…
Q: Consider the fructose-1,6-bisphosphatase reaction. Calculate the free energy change if the ratio of…
A: The objective of this question is to calculate the free energy change (ΔG) for the…
Q: A coal fire plant uses 1 kg of coal to generate 1000 kWh of electricity and emits 50 kg of CO2 and 5…
A: The objective of the question is to understand the relationship between the functional unit (FU) and…
Q: Indicate (in the boxes) the kinetic parameters you can extrapolate from the Lineweaver - Burk Plot.…
A: Solution:Kinetic Parameters Extrapolated from Lineweaver-Burk Plot:From the Lineweaver-Burk plot,…
Q: What is the chemistry principle behind when (treatment: heavy cream, evaporated milk, and NFDM) is…
A: The behavior of dairy products beneath diverse conditions, including temperature variations and…
Q: Estimate the viscosith of 1.0 vol % agarose gel solution if it took 58 minutes for 1500 base pairs…
A: In order to solve this problem, we need to first calculate electrophoretic mobility () during the…
Q: How is plasmid DNA distinguished from coli chromosomal DNA using the Qiagen Miniprep protocol?
A: In the Qiagen Miniprep protocol, plasmid DNA is distinguished from E. coli chromosomal DNA based on…
Q: ALL THAT APPLY
A:
Q: Alternative splicing: Question 15 options: results from non-spliceosome mediated splicing. is…
A: One notable difference between prokaryotic genes and eukaryotic genes is that prokaryotic genes do…
Q: In N-linked glycoproteins, the sugar molecule is usually bound to a Asp b Ser c Asn d Thr
A: Glycoproteins are conjugated biomolecules where a protein is covalently bound to a carbohydrate…
Q: Describe the propagation stage of peroxidation reaction by showing peroxidation of oleic acid.…
A: Lipid peroxidation is a process that breaks down cell membranes and can cause cell damage and lead…
Q: Genetics Question 25
A: The question is asking for the number of sister chromatids in a unicorn cell at the metaphase of…
Q: In three sentences describe how Sanger sequencing works
A: Copying DNA: To determine the sequence of DNA, scientists start by making many copies of the DNA…
Q: 7 Monomeric protein A reacts with an excess of 2-mercaptoethanol and gives protein B. The latter…
A: Certainly! Let's discuss the queries pertaining to the provided protein structures and reactions:…
Q: ANSWER A AND B PLS
A: To determine the Vmax and Km in the absence ofinhibitors, we can use the Michaelis-Menten equation,…
Q: In no more than two sentences each describe electroporation
A: There are several methods or techniques that allow us to introduce foreign DNA into the host cell,…
Q: 1. What is the isoelectric point of tyrosine? Draw out the different structures of tyrosine at each…
A: **Since you have posted multiple questions, we will provide the solution only to the first question…
Q: 5. Draw head group structures and name the following glycerophospholipid. a: Glycerophospholipid…
A: ### a: Glycerophospholipid that carries a net positive charge at pH 2.5.At a low pH such as 2.5, we…
Q: Question 12 In the tertiary structure of a protein, the R-group of valine can interact with the…
A: Proteins are bio molecules with vast diversity in their structure. They exhibit four levels of…
Q: (c) When [S] = 0.0004, what will Vo be in the absence of inhibitor? (d) When [S] = 0.0004, what will…
A: Km is the MM constant which is used as an affinity measurement for an enzyme. Km is equal to the…
Q: With the ninhydrin method, it was determined that an acyclic decapeptide consists of the following…
A: Elastase cleaves the peptide bonds formed by small hydrophobic amino acids, towards the C-terminal…
Q: Select the aldol condensation product of the following reaction. a A b B с C d D e E A H HO H NaOH,…
A: Answer: DExplanation:The mechanism:
Q: please explain the question, i am unable to input values of x
A: The dependent variable, the reaction rate (µmol/L/min), is usually plotted on the y-axis and is…
Q: What is the systematic IUPAC name of the following compound?…
A: for given compound,Option A is correct for systematic IUPAC nomenclature.Explanation:Step 1: In the…
Q: 200 ml of a 2% protein solution containing an enzyme that you want to purify. Half of the sample is…
A: In biochemistry and molecular science, enzyme purification is an essential process that isolates…
Q: What category of biomolecule would the following structure be associated with: 0= HO HO OH OH 애애 OH…
A: The structure of the molecule is given - It is a polyhydroxy keto compound having condensed…
Q: List 4 major types of inhibition modes and clearly indicate the effect on Vmax and KM for each mode?
A: “Since you have posted multiple questions, we will provide the solution only to the first question…
Q: A 6-year old boy has been admitted to A&E. He presented unconscious and on examination was…
A: Given the child's exposure to antifreeze, ethylene glycol poisoning is suspected in this instance.…
Q: a) How does the Grotthuss mechanism and proton translocation through the membranes differ from the…
A: The chemiosmotic theory (some would argue that it is still a hypothesis and not a theory) has been…
Q: What is the correct assignment of the names of the functional groups in the following nitrogen-…
A: Step 1:Structure 1:Contains imine functional group. Characteristics of imine functional group are…
Q: Now consider three sugars-glucose, glucuronic acid, and N-acetylglucosamine. Use shorthand (e.g.,…
A: The objective of the question is to identify the correct shorthand notation for the trisaccharide…
Q: (a) In the space below draw a free energy landscape diagram for the conversion of substrate (S) into…
A: Transition state theory states that as a substrate is converted into a product, a high energy state…
Q: 3. In your textbook the termi- nal enzyme catalyzing the ter- minal step of glycolysis is known as…
A: The coupled system of reactions for measuring pyruvate kinase (PK) activity involves two sequential…
Q: Asp48 E(-1) D(-2) H (c) ( To identify the critical enzyme resi- due:substrate interaction and…
A: The parameter is used to define catalytic efficiency of an enzyme. The greater the value, greater…
Q: 13. The structures of sphingosine and choline are given below. Draw the condensed structure and…
A: Sphingolipids has sphingosine as its platform molecule. Onto this sphingosine, a head group and a…
Q: Reaction rate 0.35 0.30 0.25 0.20 0.15- 0.10 0.05 0.00 0 1000 2000 Enzyme total is 5mM 3000 4000 1.…
A: MM graph is constructed by taking substrate and reaction velocity on X and Y axes respectively. The…
Q: Provide a schematic representation of the reactions in the beta
A: Beta oxidation is a fundamental metabolic process involving catabolism of fatty acids into energy as…
Q: QUESTION 5 Carbohydrates supply which element for the construction of other biomolecules? carbon…
A: Carbohydrates supply the element carbon for the construction of other biomolecules. Carbon is a…
Q: To prepare a gel sample, you want to load 50 ng total of protein/well. You have added 200 μL of…
A: Below answer given Explanation:Step 1: Step 2: Step 3: Step 4:Step 5:
Q: A coal fire plant uses 1 kg of coal to generate 1000 kWh of electricity and emits 50 kg of CO2 and 5…
A: The objective of the question is to understand the relationship between the functional unit (FU) and…
Q: List three important characteristics of plasmids and their function
A: Here is the Three important characteristics of plasmid and their functions.Autonomous…
Q: 2. (a) ( In contrast to the pyruvate dehydrogen- ase complex, the a-ketoglutarate dehydrogenase…
A: Approach to solving the question:Presence of Pi and Ca²⁺:When Pi (inorganic phosphate) is present in…
Q: 5'-AATGCCTCAGCCGATCTGCCTCGAGTCAATCGA TGCTGGTAACTTGGGGTATAAAGCTTACCCATGGTATCGTAG…
A: PCR is a lab technique used for amplification of target DNA sequence by using a thermostable DNA…
Q: (c) The tube and cylinder diagram to the right illus- trates schematically the potassium channel…
A: answers are given below.Explanation:c) the positioning of Tyr62 and Thr74 on the Alpha helix is…
Q: Given the line-weaver Burke plot below for Enzyme Y, identify the Vmax for Enzyme Y. -10 30 1/v…
A: 0.056Explanation:To find the Vmax from a Lineweaver-Burk plot, we need to take the reciprocal of…
Q: A drawing of a cell in G2 interphase is provided. The cell contains 4 replicated chromosomes with…
A: A cell in G2 interphase is a stage in the cell cycle where the cell has completed the S (synthesis)…
Q: What is(are) the only active site(s) not used in the second round of fatty acid synthase? Select all…
A: Here's a breakdown of why these are not used in the second round: Acetyl-CoA ACP Transacylase: This…
Q: (Biochemistry Topics: Glycolysis and Citric Acid Cycle) Why would a defect in the liver enzyme…
A: In mammals, fructose-1,6-bisphosphatase (Fbp) has two isotypes: liver and muscle, which are encoded…
Q: 7. Consider the structures shown. For each structure select all that apply. a) pentose, hexose or…
A: Answer and its explanation are given below.I hope it helps you Explanation:
Step by step
Solved in 2 steps with 1 images
- What is the major organic product obtained from the following reaction? 3 1 4 2 CH22 Zn(Cu) Et20 H3C H3C 1 2 IH2CWhat is the major organic product obtained from the following reaction? CH3 2 4 3 1 (CH3)2C=CH2 HF CH3 CH3 CH3 1 2 3What is the major organic product of the following sequence of reactions? CN Δ H2 (3 atm) Pt 1. LiAlH4 2. H3O+ 1 3 + 2 1 NH2 2 CN NH2 CH₂CN
- Select the aldol condensation product of the following reaction. a A b B с C d D e E A H HO H NaOH, EtOH heat H H B D EC Select the product of the following aldol condensation reaction. a A b B C [] d D e E A H H H B H KOH, EtOH heat OH с D EWhat is the major organic product obtained from the following reaction? NaOH, H,O Δ ཨི ཁ (O) 2 ས () 3 1 4 3 2
- 3. Consider the reaction: H3C-(CH₂) H H C—C—C—SCOA HH H₂C-(CH₂) a. What kind of reaction is being performed here? b. What enzyme performs this reaction? -C—C—C—SCOA H H c. What cofactors, if any, are required for this reaction?4c give the product if the reaction will occur, write no reaction if noneDraw the major organic product for the following reaction. 1. LiAlH ཝ་རི་-w;"", - CH3-C C-CH 2.