1. What would be the amino acid sequence encoded by the mRNA 5' C C A U G A C G U C G G A U C A A U G A G C 3' 2. If the nucleotide bolded and underlined in red in part 1 changes from C to a G, what type of mutation would that be? 3. What would happen to the amino acid sequence if the C bolded in red in part 1 is changed to a G? 4. What would happen to the amino acid sequence if the C bolded in red is deleted?

1. What would be the amino acid sequence encoded by the mRNA 5' C C A U G A C G U C G G A U C A A U G A G C 3' 2. If the nucleotide bolded and underlined in red in part 1 changes from C to a G, what type of mutation would that be? 3. What would happen to the amino acid sequence if the C bolded in red in part 1 is changed to a G? 4. What would happen to the amino acid sequence if the C bolded in red is deleted?

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 5TYK: Which of the following statements is false? a. GTP is an energy source during various stages of...

See similar textbooks

Similar questions

Which of the following statements is false? a. GTP is an energy source during various stages of translation. b. In the ribosome, peptidyl transferase catalyzes peptide bondformation between amino acids. c. When the mRNA code UAA reaches the ribosome, there isno tRNA to bind to it. d. A long polypeptide is cut off the tRNA in the A site so its Metamino acid links to the amino acid in the P site. e. Forty-two amino acids of a protein are encoded by 126nucleotides of the mRNA.
1. Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 3’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 5’ a. What is the amino acid sequence based on this mRNA? b. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?
5' C C A U G A C G U C G G A U C A A U G A G C 3' 2. If the nucleotide bolded and underlined in red in part 1 changes from C to a G, what type of mutation would that be? 3. What would happen to the amino acid sequence if the C bolded in red in part 1 is changed to a G? 4. What would happen to the amino acid sequence if the C bolded in red is deleted?
14. Now imagine that a mutation occurred in the g of the codon below and the G became a C. How would this affect the mRNA and the amino acid for that codon? New amino acid Old DNA Old RNA codon Old amino acid New mRNA codon New DNA codon codon АТС АTG 15. This would be an example of which type of a point mutation? 16. Finally, imagine that a mutation occurred in the codon below and an A was inserted between the two Ts. How would this affect the mRNA and the amino acid for that codon? Old DNA codon TTG Old RNA codon Old amino acid New DNA codon TATG New mRNA codon New amino acid 17. This would be an example of which type of a mutation?
2. Transcribe the following gene sequence to the appropriate MRNA codons: TCA TTT CCA CAG ACA * AGU AAA GGU GUc UGU 3. Translate the mRNA codons (i.e. your answer to question 2) into the appropriate amino acids using the following Universal Genetic Code Chart. * Universal Genetic Code Chart Messenger RNA Codons and the Amino Acids for Which They Code SECOND BASE A UCU UAU UGU UUU UUC UUA PHE TYR CYS UCC UCA UAC UGC SER UAA UGA STOP LEU STOP UUG UGG} TRP UCG UAG CUU CCU CAU CGU HIS CUC CCC CAC CGC LEU PRO ARG CCA CCG CUA CAA CGA GLN CUG CAG CG AUU AUC ACU AAU AGU AGC AGA ASN SER ILE ACC AAC THR AAA AAGS ACA AUA AUG MET or START LYS ARG ACG AGG S GCU GCC GUU GAU GGU ASP GUC GAC GGC VAL ALA GLY GUA GCA GCG GAA GGA GGG GLU GUG GAG トエーCロ ASE A, L-RST BASE
1. DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’mRNA:polypeptide chain: 2. a. From the given DNA sequence above, change one base in codon 6 to show nonsense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 6 3. a. From the given DNA sequence above, change the third base in codon 4 to show missense mutation. Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 4 4. a. From the given DNA sequence above, change one base in codon 8 to show same sense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 8 5. Add an A before codon 3 or delete the middle base in codon 3 to show the shift of reading…
1. Given the anticodon in tRNA is CUU, name the amino acid that will be added. 2. Given the anticodon in tRNA is CUU, what is the complementary codon? 3. How many synonyms code for arginine? 4. How many codons code for the amino acid cysteine? 5. How many codons code for the amino acid histidine? 6. How many codons code for the amino acid threonine?
1. Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Translate the mRNA. (Using the 3-letter code for amino acids, write the primary structure of the peptide that will be produced.) 2. Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Translate the mRNA. (Using the 3-letter code for amino acids, write the primary structure of the peptide that will be produced.)
1. The following is the DNA sequence of a gene: 3' TACTAACTTAGCCTCGCATC S' a. What amino acids are coded by this sequence? b. An adenine is inserted in this strand after the first guanine from the left. The resulting polypeptide is six amino acids long. Where is the newly produced nonsense codon located? What is the amino acid sequence in the fragment?
11. Determine the genetic codes for the following sequence of 3 amino acids: Asn-Glu-Lys. a. Provide one possible mRNA sequence for this peptide segment. b. Provide the corresponding tRNA anticodon for each amino acid. c. Provide the template DNA sequence for that mRNA. Table 1: Table of codons for amino acids. 1st position (5' end) C 2 G 2nd position (middle) U Phe F Phe F Leu L Leu L Leu L Leu L Leu L Leu L lle 1 lle 1 lle 1 START/Me tM Val V Val V Val V Val V. C Ser S Ser S Ser S Ser S Pro P Pro P Pro P Pro P The T The T The T The T Ala A Ala A Ala A Ala A Tyr Y Tyr Y STOP STOP His Hi His H Gln Q Gin Q Asa N Asa N Lys K Lys K Asp D Asp D Glu E Glu E G Cys C CVS C STOP Trp W Arg R Arg R Arg R Arg R Ser S Ser S Arg R Arg R Gly, G Saly, G Gly G G Gly *START codon signals the initiation of a peptide chain. *STOP codons signal the end of a peptide chain. 3rd position (3' end) JUAG C DURG C SCAG DUAG C
1. Given the piece of MRNA: 5'-CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCC-3' 1. Predict the DNA strand sequence from which it was transcribe 2. List the complementary non-coding DNA Sequence 3. List the Amino acid Sequence of the protein coded for. Use the Genetic Code 2. Below is a short segment of a DNA molecule. Translate the DNA codon into MRNA. 5'- TACCATGAGAATTGTGG TCACCTTTTT-3' 3'- ATGGTACTCTTAACACCAGTGGAAAA A-5' MRNA Sequence Amino Acid Sequence
5. Fill in the following information for making the following polypeptide (the codon chart is below). Transcribe & Translate the following strand of DNA DNA mRNA Amino acid (abbreviation) 6. Fill in the following information for mutated DNA (the codon chart is below) Transcribe & Translate the following strand of mutated DNA DNA C. MRNA Amino acid (abbreviation) D Focus 188% C0 words EO 梦 0 69°F N 耳 a W 63 ip