1. The following image shows a mechanism in which gene expression activity is regulated by ligand.ArgRS-2TeuMetRBSLigandRBS hiddena. What is this kind of regulatory machnism called?b. Does it involve transcription or translation?c. What happens in the presence of the ligand?d. What happens in the absence of theligand?e. What do you think the genes that are regulated here - metabolic (breakdown) or anabolic (buildup) forthe ligand? Explain

Name: 1. The following image shows a mechanism in which gene expression act
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 1. The following image shows a mechanism in which gene expression activity is regulated by ligand.ArgRS-2TeuMetRBSLigandRBS hiddena. What is this kind of regulatory machnism called?b. Does it involve transcription or translation?c. What happens in t

In prokaryotes, the synthesis of the gene's transcript and its encoded protein product is termed…

Science

Biology

1. The following image shows a mechanism in which gene expression activity is regulated by ligand. Arg R3-R Leu Met RBS a. What is this kind of regulatory machnism called? b. Does it involve transcription or translation? Ligand RBS hidden c. What happens in the presence of the ligand? d. What happens in the absence of theligand? e. What do you think the genes that are regulated here - metabolic (breakdown) or anabolic (buildup) for the ligand? Explain

1. The following image shows a mechanism in which gene expression activity is regulated by ligand. Arg R3-R Leu Met RBS a. What is this kind of regulatory machnism called? b. Does it involve transcription or translation? Ligand RBS hidden c. What happens in the presence of the ligand? d. What happens in the absence of theligand? e. What do you think the genes that are regulated here - metabolic (breakdown) or anabolic (buildup) for the ligand? Explain

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter16: Regulation Of Gene Expression

Section: Chapter Questions

Problem 1TYK

See similar textbooks

Similar questions

1. Which of the following signaling events is NOT engaged downstream of phospholipase C (PLC)-gamma activation? a. Calcium ion (Ca2+) release from the endoplasmic reticulum (ER) b. Heterodimerization of the subunits c-Fos and c-Jun to form the transcription factor AP-1 c. IkappaB degradation and resulting translocation of NFkappaB into the nucleus d. Recruitment of protein kinase C (PKC)-theta to the plasma membrane e. PIP3 generation at the plasma membrane which recruits and activates Akt, leading to cytoskeletal remodeling
of gene. 12. Steroid hormone receptor complex binds to the A. transcription start site B. promoter region C. coding sequences D. poly-A sequence E. untranslated regions
Wilms tumor 1, or nephroblastoma, is caused by mutations in the WT1 gene, which encodes a transcription factor. You have identified a novel variant in WT1: Arg422Pro. You have control cells and cells that have been engineered to carry the homozygous WT1 p.Arg422Pro mutation. You want to assess effects of this mutation on a variety of endpoints. For each endpoint listed below, choose the one technique is best suited to answer the question. Choose from: array CGH, qRT-PCR, qPCR, RNA-seq, FISH, in situ hybridization, western blot, immunostaining, WT1 ChIP-seq, WT1 ChIP-PCR, ATAC-seq, 3C Endpoint Technique? WT1 protein amount (quantitative) Western blot WT1 protein binding to all enhancers, genome-wide Chip-seq WT1 mRNA amount (quantitative) WT1 protein subcellular localization Quantitative assessment of all mRNAs in these cells (genome-wide) RNAseq Chromatin interactions between a specific WT1 chromatin binding site (identified above)…
In which of the following scenarios is the signal a positive regulator of gene expression? A: B: signal D: C: signal kinase OA signal kinase OC O All of them OD signal O None of them - kinase - ➜ kinase inhibitor — factor Transcription factor inhibitor Transcription H inhibitor Transcription factor - fa inhibitor H Transcription factor Gene expression Gene expression Gene expression Gene expression
. An interesting mutation in lacI results in repressorswith 110-fold increased binding to both operator andnonoperator DNA. These repressors display a “reverse”induction curve, allowing β-galactosidase synthesis inthe absence of an inducer (IPTG) but partly repressingβ-galactosidase expression in the presence of IPTG. Howcan you explain this? (Note that, when IPTG binds a repressor, it does not completely destroy operator affinity,but rather it reduces affinity 110-fold. Additionally, ascells divide and new operators are generated by thesynthesis of daughter strands, the repressor must findthe new operators by searching along the DNA, rapidlybinding to nonoperator sequences and dissociating fromthem.)
1A.If transcription factor G is downstream of EGFR and upregulates gene H, what happens to H if Grb2 has an ER signal sequence? 1B. If transcription factor A is phosphorylated by Akt and upregulates gene B, what happens to gene B if a PI3K inhibitor is added? Choices are: A. No expression of the gene B. Upregulation even in the absence of stimulation/ EGF C. Upregulation but only in the presence of cytokine/ EGF
48. What happens in the patched-smoothened signaling system if the hedgehog is NOT present? A. In the absence of hedgehog , the cell-surface transmembrane protein called "Patched" represses transcription by degrading the "Smoothened" protein located on the cytoplasmic vesicle B. Hedgehog binds to the smoothened factor which inhibits and represses transcription by activating mutations C. The absence of the hedgehog protein induces transcription by allowing the patched portion to be silenced causing the smoothened protein to activate D. There is no relevance of the hedgehog, since transcription will occur regardless due to the presence of the Gli protein which acts as a transcription promoting factor.
propose three festurs of a model to connect the genetic mutation you oredicted with the activity of a signaling pathway involving the LDS2B gene product
21. Which of the following is NOT a function/ property of the Signal Recognition Particle a. transfer protein across the ER membrane b. bind to SRP receptor c. bind to the signal sequence d. interrupt protein translation e. dissociate from the ER upon hydrolysis of GTP.
1. A mutation was introduced to the active site of the enzyme in a receptor tyrosine kinase so that it remains active in the absence of a substrate. What is the effect of this mutation on the signal transductionpathway?A. The phosphatase activity of the enzyme will be activated which will lead to receptor dimerization and subsequent cellular response.B. The signal molecule will bind to the receptor and dimerization will occur but the subsequent cellular response will be inhibited.C. The signal molecule will bind to the receptor but dimerization and subsequent cellular response will be inhibited.D. The signal molecule will bind to the receptor which will then triggers receptor dimerization and downstream cellular response. 2. Which of the following is not an advantage of non-coding regions of DNA?A. Some of these regions contain inactivated genes that can be reactivated upon insertion of regulatory sequences by mobile DNA elements.B. Some of these regions protect eukaryotic DNA from…
6. Explain why the RTK signaling pathway includes the extra complication of having a protein (Ras) that switches between GTP- and GDP-bound states.
Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA? A. Break point cluster region protein that may function as a GTPase B. A coagulation factor C. An enzyme involved in the breakdown of glycosaminoglycans (GAGs) D. Transcription factor involved in the DNA damage response E. A component of hemoglobin F. A tyrosine kinase G. Serine/threonine kinase involved in the DNA damage response H. A tumor suppressor involved in WNT signalling I. A DNA repair enzyme involved in nucleotide excision repair