1 starting with datp and dctp draw the synthesis of d(ac) dinucleotide. 2 draw the guanine nucleobase and label all possible H- bond donors and H - bond acceptors 3 Name three types of RNA and briefly describe how each function
Q: Select ALL statements that are true about the isoelectric point (pI) of a protein a.Protein carries…
A: The isoelectric point (pI) of a protein is the pH at which the protein is neutral or the overall…
Q: Exam pe reaction That require energy Catabolic Allosteric site ADP+POATP Entropy increases 2nd law…
A: Enzymes are catalysts that speed up biochemical reaction. These are workable under particular…
Q: 15-24 b) c) Identify the molecules oxidized and reduced in the following reactions: a) CH₂CH₂CHO +…
A: Many redox reactions occur during metabolism. Redox reactions necessitate the transfer or removal of…
Q: How does ATP regulate the activity of PFK-1? ☐☐ ATP binds to PFK-1 at the catalytic site as a…
A: Glycolysis is a process in which glucose is oxidized & is converted to pyruvate and in that…
Q: Which symptom is the best indication of Lesch-Nyhan disease in a patient? Chronic lysis of red blood…
A: Lesch-Nyhan disease is a rare genetic syndrome caused due to hypoxanthine-guanine phosphoribosyl…
Q: 2. Another bodily process is the urea cycle. However, a carbamoyl phosphate is necessary to begin…
A: Carbamoyl phosphate is synthesized with the help of enzyme carbamoyl phosphate synthetase requiring…
Q: What could be seen in the organic acid precipitation during the protein denaturation experiment if…
A: Proteins are large molecules made up of amino acid residues linked via a peptide bond. Amino Acids…
Q: Two (2) moles of GALACTOSE are completely oxidized to CO₂ and water using the malate-aspartate…
A: Glycolysis involves a series of reactions that convert glucose into pyruvate with the production of…
Q: Finally, using the formula to convert between standard states, show that that your calculated values…
A: Chemical standard state is defined by standard conditions in chemical systems. These standard…
Q: A researcher found that a single point mutation in the genome of the SARS-CoV-2 virus resulted in a…
A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…
Q: This is the ATP accounting question. You are limited to the carbon in the following molecules:…
A: After glucose enters the cell, there are two possible fates it can undergo: enter glycolysis,…
Q: Which of the following statements is correct regarding the structures below? CHO CHO но-н H H-OH ОН…
A: Carbohydrates can be classified into different types depending on their size into the following…
Q: 5. Reciprocal regulation of glycogen phosphorylase and glycogen synthase activity.
A: Enzymes are proteins that aid in the speeding up of chemical reactions. Enzymes bind to substrates,…
Q: What is the direct source of energy that powers molecular motors? proton gradient H+ gradient…
A: Molecular motors are proteins that generate motion within the cell for various activities like…
Q: The metabolic function of the pentose phosphate pathway is: act as a source of ADP biosynthesis O…
A: The breakdown of glucose, in glycolysis provides the starting molecule required for the pentose…
Q: true/false: Glutamine synthetase is responsible for the synthesis of glutamine from glutamate.
A: Both glutamate and glutamine are non-essential amino acids. These are glycogenic amino acids.…
Q: Upon doing the experiment of Protein Denaturation, what could be observed in the precipitation of…
A: When a protein solution is boiled, the protein frequently becomes insoluble (i.e., denatured) and…
Q: how to make 100ml of TBST buffer from 1X TBS (tris buffered saline solution) and 0.1% tween-20
A: X refers to fold concentration of a sample. It means the number of times the standard or stock is…
Q: Examine the membrane lipid pictured below and answer the following questions: a. Is this lipid…
A: Fatty acids are carboxylic acids with a hydrocarbon chain. Fatty acids may be saturated or…
Q: • What is the common name of this fatty acid? cerotic acid, lauric acid, lignoceric acid, linoleic…
A: Fatty acids (FA) are aliphatic chain with one terminal carboxylic acid. Based on the presence or…
Q: Maargerines made from plant oils are healthier, since they are hydrogenated for spreadability?…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons. The…
Q: The last residue of the protein (tail) is Tryptophan, and the first residue (head) is labeled with…
A: Fluorescence Resonance Energy Transfer (FRET) or simply RET is a technique used to calculate the…
Q: Provide 3 reactions that facilitate the synthesis of oxaloacetate
A: Oxidation of glucose into pyruvate followed by oxidation of pyruvate into acetyl CoA and then…
Q: Consider a membrane that has a very high content of phosphatidic acid on the inner leaflet of the…
A: Introduction Proteins are made up of amino acids. Protein plays various function in our body. Two…
Q: In making the experiment of protein denaturation, what usually happens upon, precipitation of strong…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: QUESTION 37 If glycogen synthase kinase-3 is active (check all that apply): O glycogen will not be…
A: Glycogen is a storage-type homopolysaccharide that contains two types of glucose polymers: amylose:…
Q: 1. What mRNA sequence does the following DNA template sequence produce? DNA…
A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…
Q: Label the parts of the below lipid molecule. Is this a saturated or unsaturated lipid? H H I-U-I H…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: 17-21 Is the rea (PEP) a re
A: Glycolysis is the process of breaking down glucose into two pyruvate molecules results in the…
Q: A scientist is studying the enzyme X which is an important point of regulation in the metabolism of…
A: Enzymes are high molecular-weight protein molecules that catalyse biochemical reactions. The…
Q: What is the actual change in free energy at 37°C for the phosphoglycerate mutase reaction converting…
A: Phosphoglycerate Mutase: Phosphoglycerate Mutase is an enzyme involved in the glycolytic process.…
Q: a) L-fucose is also known as 6-deoxy-L-galactose. Note that D-galactose is a C-4 epimer of…
A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…
Q: true/false: Transamination reactions yield an a-keto acid and an amino acid.
A: The amino acids undergo reactions like transamination and deamination. As the name suggests the…
Q: Tay-Sachs disease is result from a)malfunction of cerebroside metabolism b)the accumulation of GM2…
A: Tay Sachs disease is a recessively inherited genetic disease. It is characterised by the destruction…
Q: A certain metabolic pathway can be diagrammed as: X Y A B C D where A, B, C, and D are the metabolic…
A: Metabolism is the total of all chemical transformation that takes place in a living cell. One…
Q: Draw the electron pushing mechanism
A: It is the three-dimensional representation of chiral centres on paper. Horizontal lines represent…
Q: Please describe four different modes of the regulation of the pentose phosphate pathway.
A: The pentose phosphate pathway (PPP) is a multienzyme pathway that shares a common starting molecule…
Q: Structure, localization and biological significance of glycogen.
A: Introduction Cell needs energy for various metabolic processes. Glucose breaks into pyruvate and…
Q: Calculate the isoelectric point of the tetrapeptide Ser-Leu-Phe-Pro at pH 7.0
A: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal amino acid on…
Q: Choose the statements that describe why the isomerization reaction is critical for the subsequent…
A: Glycolysis is the collection of 10 enzymatically catalysed reactions that sequentially oxidises a 1…
Q: Add curved arrows to show the mechanism of nucleophilic attack. Select Draw ||||||||||COH P : 0: | :…
A: A nucleophile is a chemical species that is negatively charged or has a high electron density or a…
Q: Explain the regulation of biochemical pathways. Describe the regulation of β-oxidation. Describe the…
A: Beta oxidation is the catabolic pathway of degradation of fatty acids to release energy. Urea cycle…
Q: When a product inhibits an enzyme by binding to the active site, which of the following would occur?…
A: Introduction Enzymes are known as biocatalyst. They increases rate of a chemical reaction by…
Q: 31) There are several modes for enzyme regulation. What's the difference between competitive and…
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: As Build's laboratory partner, help him determine the following: 1. maximum amount of the unknown…
A: Gel filtration chromatography is a type of chromatography in which proteins are separated based on…
Q: Why might a person who is gravely ill not want to participate in a placebo-controlled drug study?
A: Placebo-controlled drug study is a study done where one group of participants are given the actual…
Q: In an enzyme mechanism that generates a negative charge in the transition state, which of the…
A: When a substrate(S) binds to the active site of an enzyme(E), it leads to the formation of an ES…
Q: The inhibition of PFK-1 by ATP diminishes when the ADP concentration is high, as shown in the graph…
A: PFk-1 is an enzyme involved in glycolysis. It catalyzes the conversion of fructise-6-phoaphate to…
Q: Which of the following amino acids has a negatively charged atom in its side chain at pH 7.2? a. V…
A: Amino acids are biomolecules that have an amino group, a carboxyl group and a side group linked to…
Q: Suppose a student rinses their buret with water instead of sodium hydroxide, leaving water in the…
A: Introduction The titration is a chemical process by which the quantity of one substance of a sample…
1 starting with datp and dctp draw the synthesis of d(ac) dinucleotide.
2 draw the guanine nucleobase and label all possible H- bond donors and H - bond acceptors
3 Name three types of RNA and briefly describe how each function
4 The overall structure of dna is double helical and the bases between each strand from Watson Crick base pairs. Why does RNA make such different structure give two examples
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 2 images
- Using Figures 8.7 and 8.9 as a guide, draw a dinucleotide composed of C and A. Next to this, draw the complementary dinucleotide in an antiparallel fashion. Connect the dinucleotides with the appropriate hydrogen bonds. FIGURE 8.9 The two polynucleotide chains in DNA run in opposite directions. The left strand runs 5 to 3, and the right strand runs 3 to 5. The base sequences in each strand are complementary. An A in one strand pairs with a T in the other strand, and a C in one strand is paired with a G in the opposite strand. FIGURE 8.7 Nucleotides can be joined together to form chains caled polynucleotides. Polynucleotides are polar molecules with a 5 end (at the phosphate group) and a 3 end (at the sugar group). An RNA polynucleotide is shown at the left, and a DNA polynucleotide is shown at the right.DNA 5' ATGGCTTCTCAATACTGCTTTGTTTTGGTT 3' template strand 3' TACCGAAGAGTTATGACGAAACAAAACCAA 5' coding strand Write down the sequence of nucleotides in a fragment of an m-RNA molecule that will be produced based on the information in the DNA fragment above (start with 5' and end with 3'). If you separate codons in MRNA with blank spaces, it will be easier to do the next step. MRNA: 5' Using a three-letter code for amino acids write the sequence of the first ten amino acids of the protein pectate lyase (refer to the table of 64 codons from a lecture or a textbook).1.Calculate the average number of nucleotide pair per micrometer of DNA double helix using the dimensions proposed by Watson and Crick. 2. Considering the number of base pairs, compute for the actual length of the given DNA strand in micrometer. (1m = 10,000Ao) 3' C G A C T A C 5' 5' G C T G A T G 3'
- 1 the overall structure of DNA is double helical and the bases between each strand form watson- crick base pairs. why does RNA make such different structure give atleast two examples. 2Draw a generic triacylgylcerol. Use R for the alkyl groups.1. Which one of these indicated groups or bonds: hydroxyl; phosphate; triphosphate; nitrogen base; phosphodiester bond; hydrogen bond; is present in each of the following cases: The 3' position of the last nucleotide added to the leading strand. (a) (b) The 5' position of the first nucleotide of a RNA primer. (c) The 5' position of the first deoxyribonucleotide incorporated into an Okazaki fragment. The 3' position of the last nucleotide of the RNA primer in an Okazaki fragment. (e) The 5' position of any of the deoxyribonucleotides before incorporation.10.) Draw a double-stranded DNA molecule (using different colors for each) model should clearly represent the sequence: A G T A C C G G G C A A Note: It should include items to represent - sugar molecules - phosphate molecules - 4 distinct nitrogenous base molecules (Adenine, Thymine, Cytosine, and Guanine) - two types of bonds between these molecules
- What are the complementary base pairs in DNA-RNA interactions? Answer format: Base 1(one letter symbol)-Base 2 (one letter symbol, or B-B*(hypothetical N-base) In the lengthening of a polynucleotide chain, which type of nucleotide subunit (name please not the formula) would bond to its 3’ end? How many 3’,5’-phosphodiester linkages are present in a tetranucleotide segment of a nucleic acid?Suppose the following base sequence was found in a 20-base DNA polymer. 3'CAGTTACGGCTCCTAGGTTATAATTCGTTTC 5' a. What would be the first 5 bases at the 3' end of the complementary strand? b. What would be the first 10 bases at the 5' end of the complementary strand? c. Assuming the presence of the complementary strand, what is the percentage composition of the polymer with respect to the A-T base pair? with respect to the G-C base pair? d. In the given segment in problem 1, illustrate and indicate the direction of the synthesis of: i. a 5-nucleotide RNA primer ii. a 5-nucleotide Okazaki fragmentDraw the structure of the RNA dinucleotide formed between cytidine-5’-monophosphate and adenosine-5’-monophosphate. Your structure should show cytidine with a free 5’ and adenosine with a free 3’.
- 5’ - A T G G C C C A A C T G A C C - 3’ a. How many nucleotides are listed here b. How many codons are listed here c. What are the three structural components of one nucleotide D.Write the appropriate sequence for the complementary strand above or below the sequence shown. Be sure to include which end of the complementary strand is 5’ and which end is 3 E.If the above sequence is the coding strand, write the RNA strand that will be transcribedGiven the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using the 3’ – 5’ strand as the template. use drawings, diagrams, colours and annotations to describe how the DNA strand will be synthesized into a functional protein. 5’ - TATAAAAASSMSBMDATGSBDCCMBDBAATBSMDSTGTGTCCTMSBAG – 3’ (KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in the DNA, hypothetically S pairs with B and M pairs with D).34. Draw double-stranded DNA (two basepairs long with one AT basepair and one GC basepair). Your drawing should be flat; do not draw the twist of the helix. Be sure to include the 5’-P, 3’- OH, deoxyribose sugar rings (with carbons 1’-5’ and the O indicated), and a simplified phosphodiester bond (O-P-O). Show purines as two differently-sized rings and pyrimidines as one ring and show the correct number of hydrogen bonds between bases. The dsDNA must be antiparallel. Drawing a simplified version of dsDNA will help you gain a better understanding of the concepts underlying dsDNA structure. It will most likely take a couple of tries to get a clear figure.