. What is meant by a bacterial “colony” or colony-forming unit? 2. Why are colonies that develop on a heavily seeded plate smaller than those that appear  on a sparely seeded plate? 3. What are some of the uses and advantages of the ff.: a. Agar plate b. Agar slant c. Broth culture

Q: 6. Name the three major derivatives of the ectodermal germ layer.

A: The endoderm (inner layer), ectoderm (outer layer), and mesoderm (middle layer) are the three basic…

Q: Set 3: Mutagens 51) breaks the sugar-phosphate backbone of DNA A) ultraviolet light 52) cause…

A: 51. C. Ionising radiations 52.  E. Frameshift mutagens 53.  B- Nucleotide analog 54. A,. UV rays 55.…

Q: Describe some characteristics and differences between prokaryotic and eukaryotic cells.

A: DISCLAIMER Since you have asked multiple questions, we will solve the first question for you. If you…

Q: In order of progression, state the steps that would lead to the development of natural active…

A: Principle of Active Immunity: Humoral immunity is the mechanism by which your body develops…

Q: 5. Below is an image of DNA sequenced using the Sanger sequencing method, where different…

A: Gel electrophoresis is a molecular technique that aims to separate the DNA, RNA, and protein…

Q: 21 Explain the process of photorespiration.

A: Photorespiration is the light dependent process of oxygenation of ribulose bisphosphate (RuBP) and…

Q: Assuming that 32 million histone octamers arerequired to package the human genome, how many his-tone…

A: Introduction :- Chromosome proteins are a type of protein. Histones bind to DNA, aid in the…

Q: 6.3.7 Activity 6.1 (1) List and briefly explain four methods of studying an E-S complex. (2) (a)…

A: Introduction When an enzyme comes into complete contact with its substrate, a temporary molecule…

Q: Name the tissues that compose a typical root, and compare theirarrangement in monocot and eudicot…

A: * A typical root formed by 3 layer of tissues that is the outermost epidermis tissue, middle cortex…

Q: Name and describe in DETAIL the three steps of translation.

A: The process of translating nucleic acid information into amino acids is known as translation. It…

Q: Which are phagocytes in liver ? (A) Kupffer cells (B) Aciner cells (C) Diter cells (D) Hensen's…

A: Introduction - Neutrophils, macrophages, and dendritic cells (DCs) are phagocytes with the ability…

Q: at factors in a population would mean that the Hardy-Weinberg principle does not apply? Give an…

A: Natural selection is one type of adaptive evolution mechanism. It happens because organisms with…

Q: What role does cholesterol play in the plasma membrane? Select the best answer. O It provides a…

A: Cholesterol's significance in bilayer and monolayer lipid membranes has piqued researchers'…

Q: The following strand is a template strand: 3-АТСТАСССТТCGACTAGAАСААСТ-5' The non-template strand is…

A: Given, Template strand : 3'-ATCTACCCTTCGACTAGAACAACT-5'

Q: To explain: Why do seedlings that germinate in a fully darkened room grow taller than seedlings of…

A: Every living thing is hardwired to thrive in its own environment. Nonetheless, they require a number…

Q: Why do anisogamous organisms only experience the twofold cost of sex?

A: Isogamous sexual reproduction occurs when male and female gametes have similar morphology. They are…

Q: Identify a passive tissue that could be exposed to continued plastic stress (deformation). Explain…

A: Passive tissue is those that undergo stretching when they are not even stimulated and hence…

Q: Which of the following amino acids would you expect to find more often near the center of a folded…

A: Proteins are biomolecules made up of long chains of amino acids. It is macronutrient that is…

Q: 6.3.7 Activity 6.1 2 List and briefly explain four methods of studying an E-S complex. ngenic…

A: Answer :- 1) There are various methods of studying the Enzyme-substrate complex like magnetic…

Q: Blue feather color is dominant to brown feather color. Which of the following statements is true…

A: Dominant and Recessive alleles Dominant alleles are those that mask the expression of other alleles…

Q: similar clines in allele frequencies on different continents are evidence for

A: Adaptive evolution refers to evolutionary changes in an organism that makes it more suited for its…

Q: Name and describe three types of modification that the mRNA undergoes in eukaryotes before the MRNA…

A: Ans - The three types of modifications that mRNA undergoes in eukaryotes before the mRNA is…

Q: Which of the following best describes the central dogma of molecular biology? O A) MRNA is…

A: Introduction In molecular biology, a central dogma is an illustration showing the flow of genetic…

Q: diagram that explains the core concept of flow down gradients in the urinary system/kidneys?

A: Urinary system The urinary system comprises the kidneys, urinary bladder, ureters and urethra. Its…

Q: Fill in the purity reading of each either good or bad sample as well as the remarks what makes the…

A: There are few important points: RNA is synthesized by four types of ribonucleotides and joined by…

Q: As tubular filtrate flows down the descending limb of the loop of Henle, it becomes: O hypoosmotic O…

A: Water gradually diffuses out from the descending Henle loop. The solvents in the filtrate are…

Q: The first juvenile larva of Ascaris is known as- (A) Filiform larva (B) Rhabditiform larva (C)…

A: Introduction - Humans have a "giant roundworm" called Ascaris lumbricoides, which can grow to be 35…

Q: Robert Koch (a) proposed a set of guidelines to demonstrate that a specific pathogen causes specific…

A: Microorganisms are small living organisms some of which are pathogenic and cause diseases.

Q: The formation of _ is a positive result in the VDRL test. Group of answer choices cytopathic effect…

A: Laboratory tests to detect antibodies and antigens outside of the body (e.g., in a test tube) are…

Q: write a short reflection paragraph on the role of extracellular matrix on tumor progression.

A: Cancer results from the formation of tumors that have the ability to metastasize.

Q: To explain: Why professional gardeners soak their seeds in hydrogen peroxide before planting.

A: Seeds inside each fruit are designed to germinate and grow into a new plant on their own, a process…

Q: How is it possible for some molecules to be atequilibrium across a biological membrane and yet not…

A: Introduction :- Biological membranes are made up of two sheets of lipid molecules (known as a…

Q: 6. You perform a high throughput DNA sequencing reaction on chromosome number 1 from a newly…

A: a)Arranging the fragments with overlapping sequences on the fragments ends. 2.GGCTATTTCGCCG 4.…

Q: Which stage of mitosis is shown in the picture? Prophase Telophase Metaphase Anaphase

A: Mitosis is equational division. Meiosis is reductional division.

Q: All life forms on Earth depend on plants in order to exist. Give three reasons that support this…

A: In order exist on earth every living organisms required certain things like food, water, sunlight…

Q: Why do anisogamous organisms only experience the twofold cost of sex?

A: Anisogamy is a type of sexual reproduction that involves the union or fusion of two gametes that…

Q: Which of the following statements is TRUE about corpus luteum? O A. Secretions of the corpus luteum…

A: The corpus luteum produces progesterone, which is necessary for the embryo's growth. The placenta…

Q: To explain: The impact on the phenotype of common wall cress (Arabidopsis thaliana) as a result of a…

A: Mutation is a permanent variation of some nucleotide sequences in an organism's genome that can…

Q: b) Use the DNA sequence below to answer the following questions. 3'- TACGAACGAGTGCCCCAAAATT -5' What…

A: The process of converting DNA instructions into proteins is known as the central Dogma.

Q: -In the kennedy class IV, II,I take the support from abutment and most prominent bone should have…

A: There are few important points that should kept in mind . Which are as follows: Applegate's rules…

Q: Why are okazaki fragments necessary on the lagging strand?

A: In a long DNA molecule, since the the two strands of DNA cannot be separated in its entire length…

Q: If we say that a certain STR locus has “high heterozygosity” in the human population, what do we…

A: Short tandem repeat (STR) markers or "core loci" are required for the entry of DNA genotype data…

Q: How can you avoid having infections?

A:

Q: Suppose a farmer puts antibiotics in meat that he leaves out for lion cubs. The antibiotics in the…

A: Cubs survive to adulthood due to resistance provided by antibiotics.

Q: To examine: Whether the statement "All flowers are pollinated by bees" is true or false.

A: A flower is the reproductive part of an angiosperm plant's modified thick shoot. The transfer of…

Q: "hat is the function of e these functions sin re

A: A flower is a reproductive structure found in flowering plants. It is also known as a bloom or…

Q: specifying the protein lysozyme from the bacterial virus T4 caused a change in the protein from ts…

A: INTRODUCTION Amino acids are the building blocks of proteins and nitrogenous backbones of…

Q: List some of the variations in eudicot leaf structure.

A: Eudicots are dicotyledons which means plants have two cotyledons in their seeds. Monocots are plants…

Q: ORIGIN 1 acacttgctt ctgacacaac cgtgttcact agcaactaca caaacagaca ccatgctgac 61 tgctgaggag aaggctgccg…

A: The gene contains information to code for specific proteins in the form of the nucleotide sequence.…

Q: Parasitic alveolates that form spores at some stage in their life belong to which group? (a)…

A: * The answer of the question is option D that is apicomplexans. * Parasitic alveolates that form…

Microbial Growth

The development of microbial growth is influenced by various natural conditions (both physical and synthetic) like pH, temperature, saltiness, gas focus (O2, CO2, and H2), nutrients, water action, and assimilation. Knowing the distinctive physical and chemical factors that influence the development and endurance of microbial growth in the climate will assist with reinforcing endeavors outfitted towards their control. These lines lessen or diminish their harmful impacts on humankind, creatures, and the climate.