. Using the structure of d-TMP show all the tructural fragments donated by different organic ompounds during d-TMP synthesis (in the tructure each fragment must be shown using rrow directed from the donor's name).
Q: What is the structure of the lipid?
A: Biological macromolecules are the molecules that are required in enough amount for the body. It…
Q: In another experiment using Quikchange to amplify the pQE.1-CRYGD plasmid containing our mutation,…
A: Introduction A common laboratory method for producing several copies of a specific DNA region is the…
Q: Sudupe
A: Chromosomes are the condensed form of nucleic acid. The chromosomes are formed during the cell…
Q: Which of the following statements about cellular membranes is true? Transmembrane proteins are…
A: Introduction All cells have a cell membrane, also known as a plasma membrane, which separates the…
Q: Based on the ORGANIZATION of neurons, why are some areas of skin more sensitive than others
A: Neurons are the basic structural and functional unit of nervous system. These are capable of…
Q: Which statistical calculation would be used to study the range of variation that is present in a set…
A: Introduction : The study of gathering, analysis, interpretation, presentation and organisation of…
Q: Is it better for a fatty acid to be less stiff or more stiff? How does the function change based on…
A: Fatty acids are the units of fat in our body, and it consists of an aliphatic hydrocarbon chain with…
Q: What are the predisposing factors, clinical manifestations, and management of otitis media?
A: Otitis media is infection of ear in which air-filled space behind the eardrum. This is cause by…
Q: Which tenet of the cell theory is supported by the concepts of mitosis and meiosis? Living things…
A: Introduction Cells are the primary structural and organisational unit of all living things,…
Q: c) If persons 1 and 2 have children, what is the probability that their second child will have the…
A: The alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: One possible theme of The Call of the Wild could be that only the strongest survive. Explain how…
A: According to Darwin theory, individuals with traits that enable them to adapt to their environments…
Q: 6. Do all outer cell membrane surface receptors bind G-proteins? 7. What is an example of a hormone…
A: Cellular receptors are proteins either inside a cell or on its surface, which receive a signal.
Q: Which of the following phenomena exhibit mitosis? All of the above The development of an embryo to…
A: A kind of cell division called mitosis occurs when one cell divides into two genetically identical…
Q: 5. Responsible for cell movements in eukaryotic cells: a. ribosomes b. lysosomes c.…
A: Introduction The word "cell" comes from the Latin word "cellula," which signifies a small…
Q: Which important phenomenon is both inspected during g1 and g2 checkpoints of the cell cycle? ODNA…
A: A checkpoint is a stage in the eukaryotic cell cycle where the cell examines internal and external…
Q: Hydroxyl ion (OH) is a type of the following: O a Acid O b. Base OC Buffer Od. Salt Oe. None of the…
A: According to Lewis concept Acids the those substances which can accept electrons while bases are…
Q: How is neurotransmission of pain signals modulated at the receptor, spinal cord, and brain?
A: Acetylcholine is a neurotransmitter that is synthesized from acetyl-CoA (ACoA) and choline obtained…
Q: A healthy couple had their first child affected by cystic fibrosis. Their next three sons were not…
A: The alleles are the alternative forms of a gene that are located on the same locus of a homozygous…
Q: 7. 1 Required Study the two diagrams below. Diagram A 1 2 Diagram B 2 Based on the sequence of steps…
A: Active transport is a type of transport process that helps to move molecules through the cell…
Q: Plant Cell Wall Plant cell cytoskeleton Plant Cell (Plasma) membrane Plasmodesmata of the Plant Cell…
A: Introduction : Cells are the basic structural and functional units of all living beings. A cell can…
Q: C. In 1928, Sir Alexander Fleming was studying Staphylococcus bacteria growing in culture dishes. He…
A: Bacteria are prokaryotic microorganisms very much capable of causing a disease. On the other hand,…
Q: How does the cell membrane help maintain water content homeostasis?
A: Introduction To attain balance, the body is continually attempting to control its internal…
Q: Initially, she may present her data and condusions at a scientific conference whe tists. Later, she…
A: Science is the coolest subject that revolves around every testable and prediction around the world.…
Q: Hypothetically speaking, what will be the form of chromosomes if it will condense after S phase? O…
A: The cell cycle is defined as the progression of the cells to various phases to undergo cell…
Q: Can you test the activity of topoisomerases doing in vitro assays? How?
A: Topoisomerases are the nuclear enzymes which play an essential role in the process of DNA…
Q: What is the purpose of fixing a smear? Mark all that apply: 1. To attach the bacteria to the slide…
A: The staining of microorganisms is very much important that helps us in identifying the morphology…
Q: Provide an explanation for the occurrence of the afterimage based on events occurring in the cone…
A: Introduction The human eye is the organ of the visual system which has the ability to receive visual…
Q: Why is it essential that smears be air-dried? Why can’t they be gently heated over a flame to speed…
A: Introduction : A bacterial smear is a tiny amount of culture that has been applied to the slide's…
Q: The following has a pH greater than 7 (>7): O a. Acid O b. Base O c. Buffer O d. Salt Oe. None of…
A: pH is measured as the negative log of hydrogen ion concentration. pH = - log(H+) pH is the measure…
Q: 3. The pedigree below was obtained for a rare kidney disease. a) Deduce the inheritance of this…
A: Introduction The study of a specific trait that is passed down from one generation to the next is…
Q: You expect that a lung tumor cell line has arisen due to aberrant expression of the growth factor…
A: Cancer is due to the uncontrolled proliferation of the cell. This uncontrolled proliferation is…
Q: ATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAAT…
A: The simplest definition of gene expression is the production of the gene's complementary protein,…
Q: Below are six faces. Each face represents a species. Seven characters are listed in the table, along…
A: Introduction : Maximum parsimony is an optimality criterion in phylogenetics that favours the…
Q: A blue eyed agouti hair male mouse is mated to a brown eyed yellow haired female mouse, and a test…
A: Introduction The term "phenotype" describes an organism's observable physical characteristics, such…
Q: How does skeletal system and muscular system work together?
A: Skeletal system:- skeletal system represent the internal framework of the body which is composed of…
Q: The core theme of biology that is: evolution. True False considered as the unifying theme of the…
A: Answer : True
Q: Which tenet of the cell theory is supported by the concepts of mitosis and meiosis? O Cells are the…
A: Mitosis and meiosis are the two types of cell division processes by which new cells called as…
Q: Viruses display all the characteristics of living organism but many scientists do not consider…
A: A virus is an infectious microorganism made up of a protein-coated segment of nucleic acid (either…
Q: A(n) A B C is a bit of information that is true. opinion fact data
A: Science is the study area involving the study of nature and natural organisms. It is based on proven…
Q: If nuclear DNA replicates during the S (synthesis) phase of the cell cycle, when does mitochondrial…
A: A cell cycle is the sequence of events that occur in a cell as it grows and divides.
Q: example of the fundamental concept of glomerulus.
A: Ans: Glomerulus is the filtering unit of kidney and composed of small blood vessels (capillaries),…
Q: Name 5 different physiological systems that are influenced by drugs
A: Drugs cause a brain reaction that alters how the body feels. The brain, which serves as the body's…
Q: Is the Triple-Sugar Iron Agar (TSIA) a complex or defined medium? Explain based on its composition.…
A: Introduction A solid or liquid substrate that can be used to grow cells or organ explants; a medium…
Q: Describe the difference between the artificial selection of organisms and genetically modifying…
A: Genetic engineering is a process in which genetic material is manipulated by man invitro for the…
Q: Which will happen during anaphase? Sister chromatids align at the metaphase plate Chromosomes start…
A: Introduction When a parent cell divides into two or more daughter cells, this process is known as…
Q: You are reading a scientific paper regarding the relationships of the anatomical and behavioral…
A: Introduction Evolution is the gradual change in the inherited traits of biological populations over…
Q: Which of the following phenomena exhibit mitosis? A lobe of the liver can regrow after it is…
A: Cell division is a phenomenon takes place inside the cell in which main ( parent ) cell split so as…
Q: Which set of facts is true for vaccines? They produce active immunity. They are mostly targeted…
A: Vaccination is a simple, safe, and effective method of protecting people from potentially fatal…
Q: For most cell types, serum must be added to the media to get cells to grow and proliferate in…
A: In humams serum is the plasma without clotting factors. Which means that plasma contains antibodies,…
Q: (a) Copyright © 2003 Pearson Education, Inc., publishing as Benjamin Cummings. What is the…
A: Chromosomes are thread-like structures in the nucleus that contain tightly packed DNA. It can also…
Step by step
Solved in 2 steps with 2 images
- 6. Serum blood of a patient with dislipoproteinemia type I has milky appearance even in fasting. If serum stays at low temperature (4) for several hours, the fatty layer appears on its surface. What are the possible causes of these symptoms? Answer the questions and do the following tasks: a) what compounds of serum blood must be tested in the patient in a biochemical lab? b) what is the possible diagnosis of the discase? c) draw the reaction which does not occur properly in the patient's blood; d) explain how the products of the previous reaction are used in adiposc tissue and heart in a healthy person I hour after meal.Enzymes MATCHING TYPE a.Erepsin b.Sutilains c.Chymotrypsin d.Urokinase e.Fibrinolysin f.Rennin g.Papain h.Alcalain i.Bromelains j. Pepsin 1.Additive to remove protein stains 2. Relieve symptoms of episiotomy 3. Isolated from human urine or obtained from human kidney cells by tissue culture techniques. 4. Treatment of blood clots within the cardiovascular system, exclusive of thrombi of the coronary and cerebral ateries. 5. Obtained from the stomach of Sus scrofa, Fam. Suidae and has a proenzyme: pepsinogen which is activated by HCl. 6. From Bacillus subtilis, used as wound debridement. 7. Coagulating enzyme that is present in the mucous membrane of the stomach of animals. Important in cheese making. 8. Crystallized from an extract of the pancreatic gland of Ox Bos Taurus used as an ophthalmic solution. 9. Mixture of protein-digesting & milk clotting enzymes from the juice of Ananas comosus used as meat tenderizer. 10. Found in the intestinal juice, Converts proteoses and…b. Cleavage with chymotrypsin produces the following fragments: Band A: CN , NLQY, GIVEQCCHKRSEY Band B: F, Y, DPTKM, IACCVRGF, RTTGHLCGKDLVNALY Cleavage with Staphilococcus aureus V8 protease produces the following fragments: Band A: GIVE, YNLQNYCN, QCCHKRCSE Band B: PTKM, RTTGHLCGKD, LVNALYIACGVRGFFYD What is the amino acid sequence of the protein? Type your response
- I. A protein, X, was Isolated from a pathogenlc mlcroorganism. The proteln Is a vlrulence factor whose path0genlclty lies In a heptapeptide of unknown sequence. After trypsin cleavage of the heptapeptide from protein X, the peptlde's compOsition and sequence was determined. The fOllowing were the results of the sequenclng process: 1. When the peptide was treated with dinitrofluorobenzene (DNFB), DNP-asp and a mixture of amino acids were produced. 2. When the same Intact peptide was treated with streptococcal protease, a pentapeptide of composition asp, asN, cys, gly and ser and 2 amlno acids were released. 3. When the heptapeptlde was also treated with hydrOxylamine HCI, a tripeptide and a tetrapeptide were obtained. The C-terminal amino acid of the tripeptide was asN. 1) What is the sequence of the heptapeptide if it is composed of cys, asp, lys, asN, gly and ser only? 2) What is the pl of the heptapeptide?15 Explain why detergents, which have an amphipathic structure like bile salts, are able to remove both water-based and oil-based stains.4 A I. Refer to the figure below and answer the following questions: 45 5 55 6 65 PH 7 75 8.5 0 10 B 15 20 25 30 35 Temperature (°C) 40 45 Legend: Blue - wild-type ß-galactosidase; Red - mutant ß-galactosidase a. What is the optimum pH of wild type ß-galactosidase? b. What is the optimum temperature of mutant ß-galactosidase? c. Which enzyme has the greater activity at pH 7.2? d. Which enzyme has the greater activity at a temperature of 42.5°C? e. Which enzyme has greater activity if pH decreases from 7.5 to 6.4? f. Which enzyme has greater activity if temperature increases from 40°C to 41 °C? 50 55
- 9 Give four therapeutic functions that aspirin (acetyl salicylic acid) has. Explain each in details.Rabbits were in injected with [32 P] photsphate intraperitoneally ans asacrificed after 2, 5, 8, 12, 18, 24, 48, or 168 hours of radioisotope administration. DNA, nuclear RNA (nRNA), and cytoplasmic RNA (cRNA) were prepared from the kidneys and their specific activities (radioactivity/ mg of nucleic acid) were determined 1. what can be concluded from the nRNA and cRNA curves and why 2. why didn thte specific acitivies of nRNA's and cRNA's decrease significantly after 2 days of labeling.PROTEINS 1. What will happen to free arginine after being subjected to biuret analysis (is it positive or negative, include color)2. What will happen to beef extract after being subjected to ninhydrin analysis (is it positive or negative, include color)
- 1. Briefly describe the affect of the glutamic acid to valine mutation on the Hemoglobin protein as it relates to Sickle Cell Anemia. 2. Is your prediction (from question 3 in Part I) consistent with the description of the cause of the sickle-cell anemia disease (from the BME3D computer tutorial)? Explain.2B. S. aureus hemolysin B attacks the RBC cell membrane by hydrolyzing the sphingomyelin headgroup: ОН HN .R hemolysin B cuts this bond i) Draw a plausible mechanism of hydrolysis for this lipid headgroup. Let B- and BH be general base and general acid. 00-P-O LOR2 OR, ii) Why is this damaging to the overall membrane architecture of the RBC?piysion 3. The patient went to the clinic with complaints of dizziness, shortness of breath, palpitations and pain in the limbs, which sharply worsened after a short rest in the mountains. A reduced number of red blood cells were found in the patient's blood, as well as immature crescent-shaped cells and red blood cells. What are the causes of this pathology? Why did the discase worsen in conditions of low partial pressure of oxygen?