TLHomework_6
.pdf
keyboard_arrow_up
School
Metropolitan Community College, Penn Valley *
*We aren’t endorsed by this school
Course
4087
Subject
Biology
Date
May 6, 2024
Type
Pages
2
Uploaded by PrivateBraveryKingfisher3 on coursehero.com
Tamareon Lones On-time submission: 5 pts. Total 20 pts + 6 bonus pts. Homework problems for assignment 6. 1. Name all the proteins that are in the DNA replication fork in E. Coli
, and describe the functions of these proteins. Explain how two DNA strands are replicated at the same time by one replication fork. (4 pts) -All the proteins that are in the DNA replication fork in E. Coli is SSB which function is binding to single-stranded DNA. Another protein is DnaB (helicase) which plays part in DNA unwinding. Primase (DnaG protein) which synthesize RNA primers. DNA polymerase III which performs new strand elongation. DNA polymerase I which performs filling of gaps and excision of primers. DNA Ligase which performs Ligation. Lastly DNA gyrase (DNA topoisomerase II) which performs supercoiling. -DNA strands are replicated at the same time by one replication because at the replication fork, DNA is copied differently on each strand. The leading strand is made continuously in the 5' to 3' direction, matching the helicase's unwinding of DNA. Meanwhile, the lagging strand is made in short fragments called Okazaki fragments. First, primase creates RNA primers on the lagging strand. Then, DNA polymerase elongates these primers into Okazaki fragments. Next, DNA polymerase replaces the RNA with DNA. Finally, DNA ligase joins the Okazaki fragments, creating a continuous strand. 2. The sequence of starting region of one DNA gene (the coding strand) is shown: 5’ GCATATGGCTTTTCCGCCGCGGCGACGGCTGCGC 3’. 1)
Please write down the sequence of the complementary strand (the template strand) in the 5’ to 3’ direction. (1 pt) 5' GCGCAGCCGTCGCCGCGGCGGAAAAGCCATATGC 3' 2)
If the template strand is used as a template for transcription, what is the sequence of the resulting mRNA? (1 pt) 5'GCAUAUGGCUUUUCCGCCGCGGCGACGGCUGCGC 3' 3)
From this mRNA sequence, please figure out the first codon in protein synthesis. (1 pt) 5' AUG 3' 4)
When the mRNA is used for translation, please figure out the polypeptide sequence (starting from the first codon). (2 pt) N-Met-Ala-Phe-Pro-Pro-Arg-Arg-Arg-Leu-Arg-C 5)
If one nucleotide of the coding strand is mutated, and resulting sequence is: 5’ GCATATGGCTTTTC
G
GCCGCGGCGACGGCTGCGC 3’. What is the polypeptide sequence from this mutated gene? Please explain what type of mutation this is. (3 pts) The new polypeptide sequence is N-Met-Ala-Phe-Arg-Pro-Arg-Arg-Arg-Leu-Arg-C This represents a missense mutation because the original codon is CCG, which codes for proline, is now changed to CGG and now codes for a different amino acid Arginine.
3. Please describe how the lac operon and the trp operon are regulated. (3 pts) The Lac Operon have 2 parts one being Part A which occurs when glucose is present, and lactose is absent this means that the operon is not needed. Which causes the repressor protein to bind to the operator which will turn off transcription. Then there is Part B which occurs when lactose is present, and glucose is absent. Lactose will become allolactose and bind to the repressor, which will change the repressor conformation and it cannot bind to DNA anymore. This will turn on transcription. Trp operon is regulated by tryptophan levels. If trp level is low it will turn on the operon, trp doesn’t bind to repressor or DNA and transcription is turned on. If trp level is high it will turn off the operon, trp will bind to repressor then the repressor will bind to the operator. This will turn off transcription. 4. Please summarize what you have learned from this class
, which parts of the class you enjoyed most, and which parts you didn’t like. (6 bonus pts) In this class I have learned how to draw and distinguish all 20 amino acids, How buffering systems work, and all of the protein structures including secondary, tertiary, and Quaternary. I also learned about protein synthesis, protein folding, enzymes and the inhibition of enzymes. I also was able to learn more about carbohydrates and all of there functions and Lipids and all of their functions. I also learned how to deeply understand processes like glycolysis, metabolism, the citric cycle, and DNA replication. I enjoyed DNA replication only because its very easy to understand and I have learned about it in a lot of other classes. I also enjoyed learned about the 20 Amino Acids because I have always seen them come up in previous courses but I never really understood the difference between all them, so learning about each of their function kind of made everything make sense. Lastly, I enjoyed learning about Carbohydrates even though it was a lot of information to remember. I enjoyed the structure of the class and that we were given breaks in the middle of each class because the content could get kind of tiring due to all of the information that is being discussed. I didn’t like that the answer choices for the exam questions was kind of tricky and also the exam questions were kind of worded tricky for me which kind of force you to remember every single small detail. I wish there was a study guide given cause a lot of times when it was time for me to study for exams I would procrastinate because I really didn’t know where to start.
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
- Access to all documents
- Unlimited textbook solutions
- 24/7 expert homework help
Related Questions
General Instruction: Answer the following questions completely.
1. Construct a Venn Diagram to compare and contrast the structure and function of DNA
and RNA.
DNA
RNA
2. The Continuity of life is based on heritable information in the form of DNA, and structure
and function are correlated at all levels of biological organization. Describe how the
structure of DNA is correlated with its role as the molecular basis of inheritance. (Answer
must be in 3- 5 sentences only).
arrow_forward
Legrning Task 2: Make a.model of a DNA template to deternmine the seguence of bases in th new DNA strahds
Then, answer the gulde questions that follow.
Materials: crayons. Scissors, paste/tape, used folder or illustration board
Procedure:
Use the pattern of the DNA templater (attached to this LP). Color code, phosphate = blue, deoxyribose
sugar = green, nitrogenous base as follows: adenine= yellow, thymine = pink, guanine = violet, cytosine
= red. And cut the shapes of each nucleotides.
Buld a model of a strand of a DNA molecule. The strand should contain 6 base" rungs" following the given
order of the nucleotides: Guanine, Adenine, Cytosine, Thymine, Cytosine, Guanine.
Tape the cutout pattern to form the nucieotides. This will represent the left half of DNA.
Make a complementary strand that you made in step 3. Tape the cut -out pattern again forming the
nucieotides for the second strand of the DNA molecules.
Match the bases of the first strand and the second strand. Do not tape across…
arrow_forward
Assignment_12.pdf - Adobe Reader
File Edit View Window Help
Оpen
1
/ 1
99,1%
Tools Fill & Sign Comment
3. Recombinant protein is produced by a genetically engineered strain of Escherichia coli during cell
growth. The recombinant protein can be considered a product of cell culture even though it is not
secreted from the cells; it is synthesized in addition to normal E. coli biomass. Ammonia is used as
the nitrogen source for aerobic respiration of glucose.
The recombinant protein has an overall formula of CH1.5500.31N..25. The yield of biomass (excluding
recombinant protein) from glucose is measured as o.48 g/g; the yield of recombinant protein from
glucose is about 20% of that for cells.
How much ammonia is required?
What is the oxygen demand?
If the biomass yield remains at 0.48 g /g, how much different are the ammonia and oxygen
requirements for wild-type E. coli that is unable to synthesize recombinant protein?
а.
b.
с.
24°C
08:39
Berawan
27/04/2022
arrow_forward
Activity 2. You COMPLETE Me!
Objective: Identify the methods used for inserting plasmids into the host cells.
What you need: pen and paper
What to do: On a separate sheet of paper, copy and complete the key points of the methods used
to introduce plasmids into the host cells. Choose your answers from the box
gene gun
biolistics
electric shock
mammalian cells
plasmid insertion by Heat Shock Treatment
increase the pore sizes of their plasma membranes
(2)
competent
plasmid DNA
Heat Shock
electroporation
There are three methods on introducing plasmids into the host cells namely: (1)_
(3)
Biolistics uses a (4)_ to fire DNA-coated pellets on plant tissues.
Plasmid insertion by Heat Shock Treatment is a process wherein target cells undergo a
The pretreatment is said to make the cells (6).
pretreatment procedure to (5)
the introduction of the (7)_
plasmid at about 4°C for about
30 minutes and the plasmids concentrate near the cells during
After the pretreatment, the cells are incubated with…
arrow_forward
erm test Fall 2020 (page 1 of x
A elearn.squ.edu.om/mod/quiz/attempt.php?attempt31335328&cmid%3D697149
-aming System (Academic)
Fon 3
"DNA is passed from one generation to another during cells division after DNA replication".
et
red
which of the following statements regarding DNA replication is NOT correct:
d out of
Select one:
O a. Each DNA strand of the double helix will be copied
g question
O b. The newly synthesized strand will have the complementary sequence of the parental template strand
O c. The daughter cell will have doub the amount of DNA that the parental cell had
n 4
Which of the following ketoses contain the same number of carbons as glucose?
ed
Select one:
out of
O a. Sucrose
O b. Fructose
question
O c. Ribose
O d. Galactose
O e. Aldose
5) helps maintaining the skin's cells and prevents the growth of some
arrow_forward
Answer the ff. questions:
1. At eukaryotic origins of replication, helicase cannot be activated until the polymerase is also positioned on the DNA. Explain
what would happen if the helicase became active in the absence of DNA polymerase.
2. RNA synthesis is much less accurate than DNA synthesis. Why does this not harm the cell?
3. What is the role of folate in the synthesis of nitrogenous bases of purines?
arrow_forward
Chhose correct option plz
QUESTION-
The SARS-COV-2 virus interacts with a human protein present on the surface of cells and called ACE2. If one could ever engineer ACE2 mutations that allowed ACE2 to retain its normal functions while not interacting with current variants of the virus, what could currently be most realistically achieved with this mutated ACE2 sequence, according to current knowledge?
a.Edit the genome of all cells in grown human individuals to change the sequence of the ACE2 gene
b.Edit the genome of human embryos to mutate ACE2
c.Perform reproductive cloning of human individuals that already carry the mutated ACE2
arrow_forward
es, 30 seconds.
Question Completion Status:
>A Moving to another question will save this response.
Question 11
In a molecule of double-stranded DNA, the amount of Adenine present is always equal to the amount of
1. cytosine
2. guanine
3. both guanine and cytosine
4. uracil
5. thymine
A Moving to another question will save this response.
AR
SONY
arrow_forward
Instructions:
Read 13-2 Manipulating DNA pages 322-323.
As you read each section, examine the figures and captions (explanations). Identify any
questions you may have.
1) Develop an analogy for the processes researchers use to make changes to DNA. In yo
analogy, explain how it is similar to the techniques used in genetic engineering.
You can draw a graphic organizer, make a table, or write a few sentences describing your
analogy.
2) Devise flowchart that shows the steps to prepare DNA for gel electrophoresis, as well
the protocol for setting up and running a gel. You can add diagrams to the flowchart an
add detailed notes if you like.
English (inited Sate)
O Focs
ere to search
4
CO
RU
G\
L
B.
2N
A\
Alt
Ciri
arrow_forward
Please answer fast
After the transfer of the F plasmid is complete
multiple choice 3
the F+ cell becomes F-.
the F- cell becomes F+.
F+ cell becomes antibiotic sensitive.
the F+ cell expresses an R factor.
the F- cell becomes HfR
arrow_forward
QUESTION: A 35-year-old man is known to have been HIV-positive for the past 10 years. Physical examination now shows multiple reddish purple, nodular skin lesions with the microscopic appearance shown in the figure. These lesions have been slowly increasing for the past year. Which of the following risk factors is most likely to play a role in the development of these skin lesions? A Antiretroviral therapy B Epstein-Barr virus infection C Hyperlipidemia D Mycobacterium avium complex infection E Sexual intercourse
do fast please
arrow_forward
ANSWERS 1-4 were answered but I need 5 answered please.
5. ANSWER QUESTIONS BELOW PLEASE:
A. Repeat number 4 (a through d), except do a deletion or insertion mutation, by subtracting or adding a nucleotide from the original DNA sequence from number 1. (Don’t forget to rewrite the original DNA sequence, and mutated DNA strand.)
B.
C.
D. Indicate if the results of the mutation is always beneficial, always harmful or always neutral.
QUESTIONS ANSWERED BELOW
Answer 1) The sequence of template strand in 3' to 5' sequence is:
3' TACCCGCCAGCCTACATC 5'
Answer 2)
The mRNA strand is complementary to the template strand. The RNA polymerase synthesises mRNA. The A, U, G and C are present in mRNA with respect to the T, A, C and G in DNA.
The mRNA sequence is: 5' AUGGGCGGUCGGAUGUAG 3'
The mRNA sequence in form of codon is: 5' AUG GGC GGU CGG AUG UAG 3' The codon is made up of three nucleotides.
Answer 3) The mRNA codon chart helps to find the sequence of amino acid from a codon. The…
arrow_forward
BIOTECHNOLGY
Date:
Name:
Instructor:
Section/Group:.
POST-LAB QUESTIONS
1. In one or two sentences, summarize the technique of gel electrophoresis.
2. How does the process of gel electrophoresis separate DNA fragments?
3. Why is the fact that DNA has a negative charge so important in the gel electrophoresis process?
Biotechnology 165
arrow_forward
Question:-
The success of renal transplantation depends on three human histocompatibility genes, HLA-A, HLA-B and HLA-C, which must match between the donor and the receiver. A single mismatch may cause the kidney rejection. Each gene has multiple co-dominant alleles. These three genes are located very close to each other on chromosome 6, so that the recombination rate is very low (below 1%).
The father has the following genotype: A1, A2, B24, B10, Cw4 and Cw7 and the mother is A1, A1, B11, B7, Cw5 and Cw8. Their first boy is A1, A1, B24, B11, Cw7 and Cw8. What is the probability that the second child is compatible with his/her brother?
arrow_forward
question: Can you summarize and explain for me what you want to tell in the article below? Can you explain the figure? When I read it myself, I do not understand exactly what is meant by the article. It would be nice if you could highlight the important points. You can use them in a figure or diagram to explain. thank you and hava a nice day :)
Article:
Nanotechnology Tools to Detect SARS-CoV-2
Standard procedures for detecting the virus from nasopharyngeal and/or oropharyngeal swabs have been reviewed recently and are primarily based on reverse transcription polymerase chain reaction (RT-PCR). Here, we would like to mention some preliminary ideas on nanotechnology-based assays to monitor the presence of SARS-CoV-2. A simplified test and variants thereof to detect viral proteins (e.g., HIV or influenza virus) without the need for expensive equipment is based on the color change of Au NPs bound to antibodies. Similar to the enzyme-linked immunosorbent assay (ELISA) antibodies coupled…
arrow_forward
WORKSHEET TASK 3:
1. Below is a theoretical section of DNA. Design two primers that are 10 base pairs (bp) long that will amplify this section of DNA in a PCR reaction (‘N’ refers to non-specific ‘nucleotide’).
3’–A C G T G A A C T G C C T NNN......NNN C C G T G T A T C T C T T–5’
5’–T G C A C T T G A C G G A NNN......NNN G G C A C A T A G A G A A–3’
arrow_forward
Assigned Multiple Choice Question
Please post the question that you were assigned below
During DNA replication, one of the new strands of DNA is synthesized
continuously, while the other is synthesized as a number of separate
fragments of DNA that are subsequently linked by DNA ligase. This is
because
Correct Answer
State which option is the correct one
DNA polymerase III only synthesizes DNA in the 5'-3' direction.
Explain Correct Answer
Wrong Answer #1
State which option is incorrect
replication starts at many points on the chromosome
Explain Wrong Answer #1
Identify Misconception
Discussions of misconceptions that may exist in relation to these topics and how
they may cause students to select the incorrect choice.
Wrong Answer #2
State which option is incorrect
RNA primers only anneal to one of the parental strands of DNA
Explain Wrong Answer #2
Identify Misconception
Discussions of misconceptions that may exist in relation to these topics and how
they may cause students to select…
arrow_forward
question: Can you summarize and explain for me what you want to tell in the article below? When I read it myself, I do not understand exactly what is meant by the article. It would be nice if you could highlight the important points. You can use them in a figure or diagram to explain. thank you and hava a nice day :)
Article:
Nanomaterial-Based Vaccine Development and Immunomodulation
Following the publication of the genetic sequence of SARS-CoV-2 on January 11, 2020, intense research efforts have been devoted to developing a vaccine against COVID-19. With unprecedented speed, this extraordinary scientific mobilization led the first vaccine candidate to enter the Phase I human clinical trial on March 16, 2020, and other novel candidates are rapidly following. Up to May 22, 2020, there are 10 COVID-19 candidate vaccines in clinical evaluations and 114 in preclinical development.
Concerning vaccine and immunization research, nanomaterials can assist in multiple ways to boost the…
arrow_forward
Question. Rewrite the following sentences after correction. (Subject: Biotechnology)
The variation in the length of tandem repeat of microsatellite DNA has serious translational affects as this is due to its coding region.
Correct:
If one parent has sickle cell anemia and other has carrier genotype than there is 25 % chance that any offspring is carrier.
Correct:
Sickled WBC block the flow of blood and Calcium as they stick together and caused by frame shift mutation.
Correct:
The N1303K mutation in the CFTR gene of CF patients is autosomal dominant disorder due to insertion of asparagine at 1303.
Correct:
If a person RBCs have B surface antigen and it will clump with antigen B such clumping indicates Blood type B.
Correct:
Indirect ELISA can detect polygenic gene expression.
Correct:
arrow_forward
B. Answer the following questions briefly.
1. How do we know that complementary base pairs in DNA really exist?
2. Compare and contrast replication, transcription and translation based on template used, direction of
synthesis, protein/enzyme requirements during initiation, elongation and termination and products.
CRITERIA of
Replication
Transcription
Translation
comparison
1. Template used
2. direction of
synthesis
3. protein enzyme
requirements
a. Initiation
b. Elongation
c. Termination
4. Products
3. How do we know that expression of the information encoded in DNA involves an RNA intermediate?
arrow_forward
describe the structure of a plasmid
Chemistry
arrow_forward
Restriction mapping of the delta chromosome
I need help with question two please
arrow_forward
וןווד
←
Q
Lab Report 6 worksheets 314 F22 .DOCX
File Edit View Insert Format Tools Help
A 100%
¿
Summary
Grades for Arysta Visser: 23 x M Uh-oh! There's a problem w X b The restriction EcoRI cleaves X + Untitled spreadsheet - Goog X
https://docs.google.com/document/d/1mKY1HIgMPRh1kRDCmX7msBF2yf07-ogT/edit
Outline
Headings you add to the document will
appear here.
Normal text
Times ...
12 + B I U
2
18. The restriction EcoRI cleaves double-stranded DNA at the sequence 5'-GAATTC-3', the
restriction enzyme HindIII cleaves at the sequence 5'-AAGCTT-3', and the restriction enzyme
BamHI cleaves at 5'GGATCC-3. An 805 bp circular plasmid is digested with each enzyme
individually and then in combination, and the resulting fragment sizes are determined by
means of electrophoresis. The results are as follows:
1
Restriction Enzyme(s)
EcoRI
BamHI
HindIII
EcoRI and BamHI
EcoRI and HindIII
BamHI and HindIII
3
Practice
====•=•€ EX
Fragment lengths (base pairs)
430 bp, 375 bp
470 bp, 335 bp
Lab Report 6…
arrow_forward
ull MTN-Stay Safe LTE
10:13 AM
@ 34%
#3 Mol Bio Gene o...
Complete the following tasks.
You discovered that a species of bacteria can break down Styrofoam™ (polystyrene) products due to an
enzyme it produces, polystyrenase. You wish to study the gene that codes for this
enzyme.
Task 1: DNA Extraction
To begin work on the bacterium, you begin by extracting its genomic DNA (gDNA). What is the purpose of
the following procedures? Answer briefly but completely.
Using sodium dodecyl sulfate, a detergent
Answer:
а.
b. Adding RNase A and Proteinase K during extraction
Answer:
c. Adding ethanol before recovering the DNA extract
Answer:
Task 2: Polymerase Chain Reaction
After purifying the gDNA extract, you want to isolate and amplify the polystyrenase gene. You perform PCR
using the appropriate gene-targeted primers. What is the purpose of the following PCR compon
briefly but completely.
Answer
DNA polymerase isolated from Thermus aquaticus
а.
Answer:
b. Deoxynucleotide triphosphates (DNTPS)…
arrow_forward
QUESTION:
There is an RFLP pattern that belongs to a disease. I need to find an inheritance pattern and marker related to the disease..
arrow_forward
Questions:-
6. In prokaryotes, which DNA polymerase is primarily responsible for filling in the gaps inDNA that are generated during nucleotide excision repair?7. Why can UV induced pyrimidine dimers undergo direct reversal in the light but not inthe dark?
arrow_forward
URGENT
Conjugate base questions
arrow_forward
Submit
Q4.6. What does it mean to say that extension by DNA polymerase Ill proceeds 5' 3'?
The 5' end of a DNA polymerase molecule attaches to the 3' end of primase.
DNA polymerase adds nucleotides to a growing strand, moving in the 5'-→3' direction.
DNA polymerase seals nicks as it moves along a DNA strand toward the 3' end.
DNA polymerase can only synthesize DNA at the 5' end of an existing strand of DNA.
Submit
Q4.7. In DNA replication, what is the difference between thelleading and lagging strands?
In the leading strand, DNA is synthesized 5'-3', while in the lagging strand it is synthesized 3'-5'.
The leading strand is composed of DNA only, while the lagging strand is composed of both RNA and DNA.
After extension, the leading strand is continuous, while the lagging strand is composed of disconnected fragr
The leading strand is synthesized only by DNA polymerase II, while the lagging strand is synthesized only b
Submit
i DUO in thn nrocess of being replicated. The RNA primer is sho
arrow_forward
QUESTION 1
Questions 1-5. Please fill in the blank below with the corresponding structures indicated below in the diagram:
Please ignore the fact that the fragments are colored blue and green. The coloration has no significance to this question.
Also, please don't forget to answer question 61
1. Leading strand=
2. Lagging strand=
3. A single Okazaki fragment=
4. 3' end of fragment labeled "H"=
5. Replication fork=
H
E
G
6. How many primers are required to replicate all of the DNA fragments in the above diagram (include both lagging and
leading strand)?=
arrow_forward
ANSWERS 1-3 were answered but I need 4 and 5 answered please.
Three parts are solved in case of interlinked question as per our company policy. If you want assistance with other parts, please post separately.
The DNA is made up of deoxyribonucleotide sub units. It is the genetic material.
Step 2
The deoxyribonucleotides consist of deoxyribose sugar, phosphate group and nitrogenous bases. Nitrogenous bases are adenine, guanine, thymine and cytosine.
Answer 1) The sequence of template strand in 3' to 5' sequence is:
3' TACCCGCCAGCCTACATC 5'
Answer 2)
The mRNA strand is complementary to the template strand. The RNA polymerase synthesises mRNA. The A, U, G and C are present in mRNA with respect to the T, A, C and G in DNA.
The mRNA sequence is: 5' AUGGGCGGUCGGAUGUAG 3'
The mRNA sequence in form of codon is: 5' AUG GGC GGU CGG AUG UAG 3' The codon is made up of three nucleotides.
Answer 3) The mRNA codon chart helps to find the sequence of amino acid from a codon. The start…
arrow_forward
Instructions
-Answer thr Questions properly.
MUTATION: Fill in the correct nucleotide base pairing and amino acid sequence of the mutated DNA
"MUTATED DNA"
(SEE IMAGE)
a. What is the 3’-5’ DNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX)
b. What is the mRNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX)
c. What is the tRNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX)
d. What is the amino acid sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX)
e. What is the most convincing type of mutation had occurred?
- Substitution - Missense
(Frameshift resulting Missense; Frameshift resulting Nonsense; Substitution – Silent; Substitution – Missense; Substitution – Nonsense)
arrow_forward
UPVOTE WILL BE GIVEN! ANSWER IN 3-5 PARAGRAPHS (TYPEWRITTEN)
a. What are the applications of modern biology in biotechnology?
b. What are the implications of these applications?
c. How do you think these applications will change the world in the future?
arrow_forward
What conclusions can Melia and Sophie make about their phage Zucchinibread from this experiment?
arrow_forward
UPVOTE WILL BE GIVEN! ANSWER IN 3-5 PARAGRAPHS (TYPEWRITTEN)
a. What are the applications of modern biotechnology in the field of engineering?
b. What are the implications of these applications?
c. How do you think these applications will change the world in the future?
arrow_forward
SEE MORE QUESTIONS
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Related Questions
- General Instruction: Answer the following questions completely. 1. Construct a Venn Diagram to compare and contrast the structure and function of DNA and RNA. DNA RNA 2. The Continuity of life is based on heritable information in the form of DNA, and structure and function are correlated at all levels of biological organization. Describe how the structure of DNA is correlated with its role as the molecular basis of inheritance. (Answer must be in 3- 5 sentences only).arrow_forwardLegrning Task 2: Make a.model of a DNA template to deternmine the seguence of bases in th new DNA strahds Then, answer the gulde questions that follow. Materials: crayons. Scissors, paste/tape, used folder or illustration board Procedure: Use the pattern of the DNA templater (attached to this LP). Color code, phosphate = blue, deoxyribose sugar = green, nitrogenous base as follows: adenine= yellow, thymine = pink, guanine = violet, cytosine = red. And cut the shapes of each nucleotides. Buld a model of a strand of a DNA molecule. The strand should contain 6 base" rungs" following the given order of the nucleotides: Guanine, Adenine, Cytosine, Thymine, Cytosine, Guanine. Tape the cutout pattern to form the nucieotides. This will represent the left half of DNA. Make a complementary strand that you made in step 3. Tape the cut -out pattern again forming the nucieotides for the second strand of the DNA molecules. Match the bases of the first strand and the second strand. Do not tape across…arrow_forwardAssignment_12.pdf - Adobe Reader File Edit View Window Help Оpen 1 / 1 99,1% Tools Fill & Sign Comment 3. Recombinant protein is produced by a genetically engineered strain of Escherichia coli during cell growth. The recombinant protein can be considered a product of cell culture even though it is not secreted from the cells; it is synthesized in addition to normal E. coli biomass. Ammonia is used as the nitrogen source for aerobic respiration of glucose. The recombinant protein has an overall formula of CH1.5500.31N..25. The yield of biomass (excluding recombinant protein) from glucose is measured as o.48 g/g; the yield of recombinant protein from glucose is about 20% of that for cells. How much ammonia is required? What is the oxygen demand? If the biomass yield remains at 0.48 g /g, how much different are the ammonia and oxygen requirements for wild-type E. coli that is unable to synthesize recombinant protein? а. b. с. 24°C 08:39 Berawan 27/04/2022arrow_forward
- Activity 2. You COMPLETE Me! Objective: Identify the methods used for inserting plasmids into the host cells. What you need: pen and paper What to do: On a separate sheet of paper, copy and complete the key points of the methods used to introduce plasmids into the host cells. Choose your answers from the box gene gun biolistics electric shock mammalian cells plasmid insertion by Heat Shock Treatment increase the pore sizes of their plasma membranes (2) competent plasmid DNA Heat Shock electroporation There are three methods on introducing plasmids into the host cells namely: (1)_ (3) Biolistics uses a (4)_ to fire DNA-coated pellets on plant tissues. Plasmid insertion by Heat Shock Treatment is a process wherein target cells undergo a The pretreatment is said to make the cells (6). pretreatment procedure to (5) the introduction of the (7)_ plasmid at about 4°C for about 30 minutes and the plasmids concentrate near the cells during After the pretreatment, the cells are incubated with…arrow_forwarderm test Fall 2020 (page 1 of x A elearn.squ.edu.om/mod/quiz/attempt.php?attempt31335328&cmid%3D697149 -aming System (Academic) Fon 3 "DNA is passed from one generation to another during cells division after DNA replication". et red which of the following statements regarding DNA replication is NOT correct: d out of Select one: O a. Each DNA strand of the double helix will be copied g question O b. The newly synthesized strand will have the complementary sequence of the parental template strand O c. The daughter cell will have doub the amount of DNA that the parental cell had n 4 Which of the following ketoses contain the same number of carbons as glucose? ed Select one: out of O a. Sucrose O b. Fructose question O c. Ribose O d. Galactose O e. Aldose 5) helps maintaining the skin's cells and prevents the growth of somearrow_forwardAnswer the ff. questions: 1. At eukaryotic origins of replication, helicase cannot be activated until the polymerase is also positioned on the DNA. Explain what would happen if the helicase became active in the absence of DNA polymerase. 2. RNA synthesis is much less accurate than DNA synthesis. Why does this not harm the cell? 3. What is the role of folate in the synthesis of nitrogenous bases of purines?arrow_forward
- Chhose correct option plz QUESTION- The SARS-COV-2 virus interacts with a human protein present on the surface of cells and called ACE2. If one could ever engineer ACE2 mutations that allowed ACE2 to retain its normal functions while not interacting with current variants of the virus, what could currently be most realistically achieved with this mutated ACE2 sequence, according to current knowledge? a.Edit the genome of all cells in grown human individuals to change the sequence of the ACE2 gene b.Edit the genome of human embryos to mutate ACE2 c.Perform reproductive cloning of human individuals that already carry the mutated ACE2arrow_forwardes, 30 seconds. Question Completion Status: >A Moving to another question will save this response. Question 11 In a molecule of double-stranded DNA, the amount of Adenine present is always equal to the amount of 1. cytosine 2. guanine 3. both guanine and cytosine 4. uracil 5. thymine A Moving to another question will save this response. AR SONYarrow_forwardInstructions: Read 13-2 Manipulating DNA pages 322-323. As you read each section, examine the figures and captions (explanations). Identify any questions you may have. 1) Develop an analogy for the processes researchers use to make changes to DNA. In yo analogy, explain how it is similar to the techniques used in genetic engineering. You can draw a graphic organizer, make a table, or write a few sentences describing your analogy. 2) Devise flowchart that shows the steps to prepare DNA for gel electrophoresis, as well the protocol for setting up and running a gel. You can add diagrams to the flowchart an add detailed notes if you like. English (inited Sate) O Focs ere to search 4 CO RU G\ L B. 2N A\ Alt Ciriarrow_forward
- Please answer fast After the transfer of the F plasmid is complete multiple choice 3 the F+ cell becomes F-. the F- cell becomes F+. F+ cell becomes antibiotic sensitive. the F+ cell expresses an R factor. the F- cell becomes HfRarrow_forwardQUESTION: A 35-year-old man is known to have been HIV-positive for the past 10 years. Physical examination now shows multiple reddish purple, nodular skin lesions with the microscopic appearance shown in the figure. These lesions have been slowly increasing for the past year. Which of the following risk factors is most likely to play a role in the development of these skin lesions? A Antiretroviral therapy B Epstein-Barr virus infection C Hyperlipidemia D Mycobacterium avium complex infection E Sexual intercourse do fast pleasearrow_forwardANSWERS 1-4 were answered but I need 5 answered please. 5. ANSWER QUESTIONS BELOW PLEASE: A. Repeat number 4 (a through d), except do a deletion or insertion mutation, by subtracting or adding a nucleotide from the original DNA sequence from number 1. (Don’t forget to rewrite the original DNA sequence, and mutated DNA strand.) B. C. D. Indicate if the results of the mutation is always beneficial, always harmful or always neutral. QUESTIONS ANSWERED BELOW Answer 1) The sequence of template strand in 3' to 5' sequence is: 3' TACCCGCCAGCCTACATC 5' Answer 2) The mRNA strand is complementary to the template strand. The RNA polymerase synthesises mRNA. The A, U, G and C are present in mRNA with respect to the T, A, C and G in DNA. The mRNA sequence is: 5' AUGGGCGGUCGGAUGUAG 3' The mRNA sequence in form of codon is: 5' AUG GGC GGU CGG AUG UAG 3' The codon is made up of three nucleotides. Answer 3) The mRNA codon chart helps to find the sequence of amino acid from a codon. The…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education