Week+7b+Prokaryotic+Gene+Expression+v2

Write the CODON that corresponds with each amino acid. There may be more than one. The full names are written, but the codon chart only shows the first three letters.   glycine ______________________ phenylalanine ______________________ arginine ______________________

Write the order of nucleotides in mRNA that would be transcribed from the following strand of DNA: GTATACCAGTCATTTGTCThen list in order the amino acids coded by this sequence.mRNA ________________________________________________________________amino acids ________________________________________________________________ 2. Sometimes a mistake occurs in the translation of an mRNA strand. Suppose that the reading of themRNA strand in question 1 began, by mistake, at the second nucleotide instead of the first. The first codonwould be AUA. Write the sequence of amino acids that would be formed.__________________________________________________________________________

Posttranslational processing enzymes may cleave a____________ or add chemical constituents to it

A _____________ is a purine-rich sequence in close proximity to AUG on a prokaryotic mRNA that binds to a complementary sequence on the 30S ribosome subunits, thereby promoting the formation of the correct preinitiation complex.

Write the order of nucleotides in mRNA that would be transcribed from the following strand of DNA: GTATACCAGTCATTTGTC. Then list in order the amino acids coded by this sequence: mRNA ________________________________________________________________ Amino acids _____________________________________________________________

I have a presentation on the discovery of the genetic code, but I don't know how to organize my presentation.

If a codon GCA codes for the amino acid alanine in a prokaryote, what will it code for in a eukaryote? _____

DNAT  A  C         C  G  C      C  C  C        A  T  G      A  T  G       A  A  T       A  C  C     G  G  G     A  C  T    mRNA  ______     ______     ______      ______     ______     ______     ______      ______   ______      AA        ______     ______     ______      ______     ______     ______     ______      ______   ______

This question refers to the mRNA sequence below: 5-CCGUAUGCAUUUCGGACUUAGUAAGGACUGACAUAA-3' As this mRNA is translated, the sixth codon is Fill in the blank with the correct codon without any spaces, and nothing else, so that Moodle can grade your question correctly.

_____________ are molecular machines that excise introns from pre-mRNA and then join exons together.

DNAT  A  C        C  G  C     T  C  C       G  C  C       G  T  C       G  A  C      A  A  T         A  C  C      A  C  T    mRNA  ______     ______     ______      ______     ______     ______     ______      ______   ______      AA         ______     ______     ______      ______     ______     ______     ______      ______   ______

The assembly of transcription factors on a promoter begins some 25 nucleotides upstream where it binds to a start _______________ sequence Group of answer choices TAAT ATTA TATA ATGC

In _____________ heterogeneity, mutations in one of two or moredifferent genes can cause the same disease.

Complete what is being asked and finally with the Genetic Code table, determine what specific amino acids will be finally formed. Given DNA strand       3’ T A C T A G C C T A C T G C G 5’ 1. The partner strand of the given _________________________________ 2. The mRNA strand formed _____________________________________ 3. The tRNA _________________________________________________ 4. The amino acids formed are __________________________________

___________________ stabilize the structure of DNA and proteins.

This question refers to the mRNA sequence below: 5'-CCGUAUGCAUUUCGGACUUAGUAAGGACUGACAUAA-3' What is the third amino acid in the protein formed from this mRNA? Fill in the blank with the name of the correct amino acid and nothing else so that Moodle can grade your question correctly.

This question refers to the mRNA sequence below: 5'-AGCUGAUGGGCUGGUGCCG AGAAAGUUAGGUAA-3' What is the name of the sixth amino acid in the protein formed from this MRNA? Fill in the blank with the correct amino acid name, but nothing else so that Moodle can grade this question correctly.

During the transcription elongation step, an internal structure in the RNA Polymerase called _______________________ guides the template and non-template DNA  strands through channels inside the enzyme.   rudder alpha sigma flap zipper

Select the correct terms: The genetic code demonstrates (ambiguity / redundancy) because some amino acids are coded by more than one codon. The lack of (ambiguity / redundancy) in the genetic code is evidenced by the fact that each codon codes for one, and only one, amino acid.

RNA that is not directly involved in polypeptide synthesis is called _____________.

_____________ is a polymeric network in the prokaryotic cell wall in which short peptide chains are linked to carbohydrate chains.

What is transcription

Describe post-transcriptional modifications that occur in mRNA and tRNA. Please type your answer. Thank you

This question refers to the mRNA sequence below: 5'-AGCUG AUGGGCUGGUGCCGAGAAAGUUAGGUA A-3' What is the name of the third amino acid in the protein formed from this mRNA? Fill in the blank with the correct amino acid name, but nothing else so that Moodle can grade this question correctly.

Rare gain-of-function mutations cause increased _______________production, synthesis of an altered protein, or productionof the normal protein in the wrong context.?

What is known as zip code binding protein 1 (ZBP1) ?

write a correct terminology/word on column B that meet the description of column A COLUMN A COLUMN B 1. The site for protein synthesis where mRNA and tRNA meets.   2. Benign tumours or warts that might cause problems but do not spread to oyher parts of the body.   3. A nucleotide sequence that is complimentary to the mRNA codon.   4. A condition that depicts injury or diseased state of liver.   5. Term used to describe a process or condition which affects the general body function.   6. A type of virus that attacks the respiratory system to cause flue   7. The fluid found within the cell   8. A condition which describes harm, damage or impairment of kidney function.   9. To spilt a molecule or chemical bond.   10. The protein coat or shell of a virus

What is the transcribed sequence

__________ and_______________ are two granular organelles (enzyme complexes) that, respectively, synthesize and degrade proteins.

Question 13 The absence of a sigma factor will never initiate transcription. A True B) False

What is the complementary DNA sequence to the following DNA sequence?   ATGCCATCG     ____________________________  Write the mRNA codon sequence for the following DNA sequence.   CTGCACTGA    ____________________________   Write the anticodon tRNA sequence for the following mRNA sequence.   UACGACUAG    ____________________________    Name the amino acids that use the following mRNA codons.   CAU ______________________________   AUG ______________________________   AAG ______________________________   CCC ______________________________   Name the amino acids that use the following DNA codons   TAT ______________________________   CGA ______________________________  List the amino acid sequence for the following mRNA code.  Be sure that you start with the first start codon you get to and then proceed to list the amino acids until you get to a stop codon.   CGUAUGACUGGAAUACUUUAGCCAGCU   __________________________________________________________________

Translate to amino acids the strand using the Genetic Code chart. Remember to use the start and stop sequences.  UGCGAUGGCAAUCGGUGUACCCCUGACUGAGC